Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pHnS KI;Sptbn4 Donor;3xV5 KO;Nfasc Resource Report Resource Website |
RRID:Addgene_240296 | KI gRNA for Sptbn4 | Other | Ampicillin | Vector Backbone:pHnS; Vector Types:AAV; Bacterial Resistance:Ampicillin | NA | 2026-08-29 01:24:38 | 0 | ||
|
pHnS KI;Sptbn4 Donor;3xV5 KO;Template Resource Report Resource Website |
RRID:Addgene_240295 | KI gRNA for Sptbn4 | Other | Ampicillin | Vector Backbone:pHnS; Vector Types:AAV; Bacterial Resistance:Ampicillin | NA | 2026-08-29 01:24:38 | 0 | ||
|
pHnS KI;Lmnb1 Donor;3xV5 KO;Mecp2 Resource Report Resource Website |
RRID:Addgene_240298 | KI gRNA for Lmnnb1 | Other | Ampicillin | Vector Backbone:pHnS; Vector Types:AAV; Bacterial Resistance:Ampicillin | NA | 2026-08-29 01:24:38 | 0 | ||
|
pHnS KI;Lmnb1 Donor;3xV5 KO;Template Resource Report Resource Website |
RRID:Addgene_240297 | KI gRNA for Lmnnb1 | Other | Ampicillin | Vector Backbone:pHnS; Vector Types:AAV; Bacterial Resistance:Ampicillin | NA | 2026-08-29 01:24:37 | 0 | ||
|
pHnS KI;Lmnb1 Donor;3xV5 KO;Rbfox3 Resource Report Resource Website |
RRID:Addgene_240299 | KI gRNA for Lmnnb1 | Other | Ampicillin | Vector Backbone:pHnS; Vector Types:AAV; Bacterial Resistance:Ampicillin | NA | 2026-08-29 01:24:38 | 0 | ||
|
pAAV-mGFAP(ABC1D)-2pabPAC Resource Report Resource Website |
RRID:Addgene_234547 | 2pabPAC | Other | Ampicillin | PMID:40591593 | Vector Backbone:pAAV-mGFAP(ABC1D)-*-WPRE-HBGpA; Vector Types:AAV; Bacterial Resistance:Ampicillin | None | 2026-08-29 01:24:39 | 0 | |
|
pOP590 Resource Report Resource Website |
RRID:Addgene_85947 | dCas9 and gRNA | Other | Ampicillin | PMID:30467337 | Vector Backbone:pDK46 derivative; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:24:45 | 0 | ||
|
pOP588 Resource Report Resource Website |
RRID:Addgene_85945 | dCas9 and gRNA | Other | Ampicillin | PMID:30467337 | Vector Backbone:pDK46 derivative; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:24:44 | 0 | ||
|
pOP592 Resource Report Resource Website |
RRID:Addgene_85949 | dCas9 and gRNA | Other | Ampicillin | PMID:30467337 | Vector Backbone:pDK46 derivative; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:24:45 | 0 | ||
|
pAAV2/6 Resource Report Resource Website 1+ mentions |
RRID:Addgene_240485 | AAV2 Rep and AAV6 Cap | Other | Ampicillin | Backbone Size:2907; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | 2026-08-29 01:24:43 | 2 | |||
|
pAAV2/11 Resource Report Resource Website 1+ mentions |
RRID:Addgene_240486 | AAV2 Rep and AAV11 Cap | Other | Ampicillin | Backbone Size:2907; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | 2026-08-29 01:24:44 | 1 | |||
|
pLV-dt/deltaEGFP Resource Report Resource Website |
RRID:Addgene_163919 | dtomato | Other | Ampicillin | PMID:33036232 | Vector Backbone:pLV-PGK-dt/CBA-EGFP-NLS; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | WT | 2026-08-29 01:24:45 | 0 | |
|
pMW96_6xHis-Sumo-TEV-mNG Resource Report Resource Website |
RRID:Addgene_253320 | mNG | Other | Kanamycin | PMID:38898313 | Vector Backbone:pET His6 Sumo TEV LIC cloning vector Addgene Plasmid #178066; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-29 01:26:41 | 0 | ||
|
(P2)RBSS7 Resource Report Resource Website |
RRID:Addgene_251372 | RBS S7 | Other | Kanamycin | PMID:41699564 | Note: Some sequence editors do not support enzymatic digestion and ligation reactions with both sense and antisense parts. Accordingly, the reverse compliment of this sequence’s sequencing results can be used, with the other parts in the CyanoConstruct part library, for in silico proofing. | Vector Backbone:pEZclone-NRS; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-29 01:26:45 | 0 | |
|
STK180_pSTK-0B-50KRBSGFP Resource Report Resource Website |
RRID:Addgene_235437 | 50KRBSGFP | Other | Chloramphenicol | Backbone Marker:iGEM; Vector Backbone:pSB1A2; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol | No | 2026-08-29 01:26:51 | 0 | ||
|
pCMV-HA-mCherry Resource Report Resource Website |
RRID:Addgene_191136 | mCherry | Other | Ampicillin | PMID:36109592 | Backbone Size:3773; Vector Backbone:pCMV-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:24:49 | 0 | ||
|
lenti_Puro_10N barcode Resource Report Resource Website |
RRID:Addgene_238546 | puromycin resistance cassette liked to a random 10N barcode | Other | Ampicillin | PMID:40705858 | Backbone Marker:Jonathan Weissman; Vector Backbone:n.a.; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-29 01:24:51 | 0 | ||
|
Guzit Resource Report Resource Website |
RRID:Addgene_196902 | 8xHis-tag is attached to the N-terminus of rnhA (RNase HI) Kanamycin resistant gene is inserted upstream of rnhA | Other | Kanamycin | PMID:37159417 | Primers: (1)CACCAATCTCAATGATCTTGTGG, (2)CAGTCATAGCCGAATAGCCT, (3)CGGTGCCCTGAATGAACTGC, (4)GCGTCCGCGATAGCGTAAA. Expected product size: 666 bp with primer (1) and (2), 1042 bp with primer (3) and (4). Guzit is a RNase HI(rnhA) His-tagged E. coli strain made for a cell-free expression system. His-tagged RNase HI expressed from the rnhA gene can be removed using Ni-NTA resin upon the preparation of cell-free extract. A kanamycin resistant gene was inserted upstream of rnhA using the λ-Red recombination system. Precuorsor strain is Rosseta 2. Please visit https://www.biorxiv.org/content/10.1101/2022.07.28.501919v1 for bioRxiv preprint. | Vector Backbone:this is a strain; Vector Types:; Bacterial Resistance:Kanamycin | 2026-08-29 01:24:54 | 0 | |
|
RNase III-His Resource Report Resource Website |
RRID:Addgene_196903 | "8xHis-tag is attached to the N-terminus of rnc (RNase III) Kanamycin resistant gene is inserted upstream of rnc" | Other | Kanamycin | PMID:37159417 | Primers: (1)AACGGCTATCTGGATGAGC, (2)CAGTCATAGCCGAATAGCCT, (3)CGGTGCCCTGAATGAACTGC, (4)CGATGAGTTAATGCCTGCTGCA. Expected product size: 842 bp with primer (1) and (2), 1038 bp with primer (3) and (4). RNase III-His is an E. coli strain made for a cell-free expression system. His-tagged RNase III expressed from the rnc gene can be removed using Ni-NTA resin upon the preparation of cell-free extract. A kanamycin resistant gene was inserted upstream of rnc using the λ-Red recombination system. Precuorsor strain is Rosseta 2. Please visit https://www.biorxiv.org/content/10.1101/2022.07.28.501919v1 for bioRxiv preprint. | Vector Backbone:this is a strain; Vector Types:; Bacterial Resistance:Kanamycin | 2026-08-29 01:24:56 | 0 | |
|
pKDcas9 csgD cerulean Resource Report Resource Website |
RRID:Addgene_230945 | dCas9 | Other | Kanamycin | PMID:39811663 | Vector Backbone:pdCas9; Vector Types:CRISPR; Bacterial Resistance:Kanamycin | additional tetO | 2026-08-29 01:24:55 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
