Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: 5-hydroxytriptamine receptor isoform 6
Vector Backbone Description: Backbone Size:5300; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24056873
Proper citation: RRID:Addgene_48339 Copy
Species: Mus musculus
Genetic Insert: Tfe3::ERT2
Vector Backbone Description: Vector Backbone:Bluescript; Vector Types:Mammalian Expression, PiggyBac; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23582324
Proper citation: RRID:Addgene_48756 Copy
Species: Mus musculus
Genetic Insert: Fbxl3
Vector Backbone Description: Backbone Marker:Sigma; Backbone Size:6299; Vector Backbone:p3xFLAG-CMV-10; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17462724
Proper citation: RRID:Addgene_48751 Copy
Species: Mus musculus
Genetic Insert: truncated mPer2 promoter/enhancer region (-1128 to +1060)
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3-Basic; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15699353
Comments: Minor sequencing discrepancies may exist between the mPer2 promoter reference sequence and Addgene's sequencing results, but do not affect the function of the plasmid.
Proper citation: RRID:Addgene_48743 Copy
Species: Mus musculus
Genetic Insert: truncated mPer2 promoter/enhancer region (-1128 to +386)
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3-Basic; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15699353
Comments: Minor sequencing discrepancies may exist between the mPer2 promoter reference sequence and Addgene's sequencing results, but do not affect the function of the plasmid.
Proper citation: RRID:Addgene_48742 Copy
Species: Mus musculus
Genetic Insert: mPer2 promoter/enhancer region containing mutated E-box2 (-112 to +98)
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3-Basic; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15699353
Comments: Minor sequencing discrepancies may exist between the mPer2 promoter reference sequence and Addgene's sequencing results, but do not affect the function of the plasmid.
Proper citation: RRID:Addgene_48748 Copy
Species: Mus musculus
Genetic Insert: truncated mPer2 promoter/enhancer region (-1128 to +2064)
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3-Basic; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15699353
Comments: Minor sequencing discrepancies may exist between the mPer2 promoter reference sequence and Addgene's sequencing results, but do not affect the function of the plasmid.
Proper citation: RRID:Addgene_48745 Copy
Species: Mus musculus
Genetic Insert: Nanog
Vector Backbone Description: Vector Backbone:pCR2.1TOPO; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23992847
Proper citation: RRID:Addgene_48680 Copy
Species: Mus musculus
Genetic Insert: ULK1
Vector Backbone Description: Backbone Marker:Sabatini lab; Backbone Size:7400; Vector Backbone:pLJM1; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23888043
Proper citation: RRID:Addgene_48799 Copy
Species: Mus musculus
Genetic Insert: RORb
Vector Backbone Description: Vector Backbone:CBIG; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Comments: Please note that Addgene's sequencing results identified a few differences in the vector backbone when compared to the full plasmid sequence from the depositing laboratory. According to the depositor, these differences are not a concern for the function of the plasmid.
Proper citation: RRID:Addgene_48709 Copy
Species: Mus musculus
Genetic Insert: nAChr-alpha6
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.1 Zeo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17932221
Proper citation: RRID:Addgene_48812 Copy
Species: Mus musculus
Genetic Insert: nAChr Beta 3 subunit, isoform 1
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:5597; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17932221
Comments: *Compared to the NCBI Genbank Entrez entry for nAChr-beta3, this plasmid has a K107R amino acid residue substitution. See accession ID: AAL75573.1|AF467896_1 for the correct reference sequence.
Proper citation: RRID:Addgene_48811 Copy
Species: Mus musculus
Genetic Insert: Akt1
Vector Backbone Description: Backbone Size:4754; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23888043
Proper citation: RRID:Addgene_48806 Copy
Species: Mus musculus
Genetic Insert: Akt1
Vector Backbone Description: Backbone Size:4754; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23888043
Proper citation: RRID:Addgene_48805 Copy
Species: Mus musculus
Genetic Insert: Smo
Vector Backbone Description: Backbone Size:6833; Vector Backbone:pEF5B; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23930224
Proper citation: RRID:Addgene_49099 Copy
Species: Mus musculus
Genetic Insert: mouse ZO-1 shRNA
Vector Backbone Description: Backbone Size:7700; Vector Backbone:pLL5.0; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin
Comments: pLL5.0 derived from pLL3.7; CMV promoter replaced with 5' LTR promoter from pMSCV.
Proper citation: RRID:Addgene_37215 Copy
Species: Mus musculus
Genetic Insert: mouse ZO-1 shRNA
Vector Backbone Description: Backbone Size:7700; Vector Backbone:pLL5.0; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin
Comments: pLL5.0 derived from pLL3.7; CMV promoter replaced with 5' LTR promoter from pMSCV.
Proper citation: RRID:Addgene_37216 Copy
Species: Mus musculus
Genetic Insert: Rosa26 left targeting arm
Vector Backbone Description: Backbone Marker:Sigma; Vector Backbone:pZDonor AAVS1; Vector Types:Genomic targeting - zinc finger; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22169954
Comments: The homology arms in the ROSA26 donor vector were generated by PCR of mouse genomic DNA and insertion of the PCR-amplified right homology arm (left primer: 5-TTATTGCGGCCGCAG ATGGGCGGGAGTCTTCT-3, right primer: 5-AACA CCGCGGCAGTTTATAAATGGAGAAAAAGGAGA -3) between the NotI and SacII sites and the left homology arm (left primer: 5-TCTATGGTACCAGTTAACGGCA GCCGGAGT-3 , right primer: 5 -CGGACGAATTCTCT AGAAAGACTGGAGTTGCAGA-3) between the KpnI and EcoRI sites in the pZDonor AAVS1 vector obtained from Sigma–Aldrich.
Proper citation: RRID:Addgene_37200 Copy
Species: Mus musculus
Genetic Insert: Foxd3
Vector Backbone Description: Vector Backbone:unknown; Vector Types:Mouse Targeting, Insertion vector; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_37272 Copy
Species: Mus musculus
Genetic Insert: Foxd3
Vector Backbone Description: Vector Backbone:unknown; Vector Types:Mouse Targeting, Insertion vector for RMCE; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_37274 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.