Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 34 showing 661 ~ 680 out of 177,657 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_52690

    This resource has 1+ mentions.

http://www.addgene.org/52690

Species: Schizosaccharomyces pombe
Genetic Insert: none
Vector Backbone Description: Vector Backbone:pREP41; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_52690 Copy   


  • RRID:Addgene_52736

http://www.addgene.org/52736

Species: Homo sapiens
Genetic Insert: Toll/IL-1 Receptor adaptor protein
Vector Backbone Description: Vector Backbone:MSCV2.2; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24529375

Proper citation: RRID:Addgene_52736 Copy   


  • RRID:Addgene_52734

    This resource has 1+ mentions.

http://www.addgene.org/52734

Species: Other
Genetic Insert: NGFP+Z-fusion
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5641; Vector Backbone:pET11a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15631464

Proper citation: RRID:Addgene_52734 Copy   


  • RRID:Addgene_52699

http://www.addgene.org/52699

Genetic Insert: OpLac2 strain
Vector Backbone Description: Vector Backbone:na; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:22605776
Comments: Oplac2 was designed by a proprietary optimization strategy (developed by DNA 2.0) that incorporated codons for a subset of amino acids read by tRNAs that are the most highly charged during amino acid starvation.

Proper citation: RRID:Addgene_52699 Copy   


  • RRID:Addgene_52732

    This resource has 1+ mentions.

http://www.addgene.org/52732

Species: Other
Genetic Insert: link-NGFP
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5641; Vector Backbone:pET11a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15631464

Proper citation: RRID:Addgene_52732 Copy   


  • RRID:Addgene_52739

    This resource has 1+ mentions.

http://www.addgene.org/52739

Species: Homo sapiens
Genetic Insert: Toll/IL-1 Receptor adaptor protein
Vector Backbone Description: Vector Backbone:MSCV2.2; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24529375

Proper citation: RRID:Addgene_52739 Copy   


  • RRID:Addgene_52982

http://www.addgene.org/52982

Species: Drosophila melanogaster
Genetic Insert: FOXO
Vector Backbone Description: Backbone Size:8904; Vector Backbone:pUAST; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_52982 Copy   


  • RRID:Addgene_52983

http://www.addgene.org/52983

Species: Drosophila melanogaster
Genetic Insert: FOXO
Vector Backbone Description: Backbone Size:8904; Vector Backbone:pUAST; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_52983 Copy   


http://www.addgene.org/52902

Species: Deinococcus radiodurans
Genetic Insert: L-IFP-F[2]
Vector Backbone Description: Backbone Marker:Addgene; Vector Backbone:pLpC; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24747815

Proper citation: RRID:Addgene_52902 Copy   


http://www.addgene.org/52903

Species: Homo sapiens
Genetic Insert: Reg-L-IFP-F[2]+Venus
Vector Backbone Description: Backbone Marker:Addgene; Vector Backbone:pLpC; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24747815

Proper citation: RRID:Addgene_52903 Copy   


http://www.addgene.org/52901

Species: Deinococcus radiodurans
Genetic Insert: L-IFP-F[1]
Vector Backbone Description: Backbone Marker:Addgene; Vector Backbone:pLpC; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24747815

Proper citation: RRID:Addgene_52901 Copy   


  • RRID:Addgene_52989

http://www.addgene.org/52989

Species: E.coli
Genetic Insert: OxyS sRNA
Vector Backbone Description: Backbone Marker:Lim lab; Vector Backbone:unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21189298
Comments: The transcription of each sRNA was controlled by the pLlacO-1 promoter, which was induced by adding isopropyl-β-d-thiogalactopyranoside (IPTG) to the media. The part of the target mRNA that is necessary for sRNA regulation was fused to gfp and constitutively transcribed from the pLtetO-1 promoter without TetR in the system. GFP fluorescence provides a quantitative measure of target gene expression and sRNA activity.

Proper citation: RRID:Addgene_52989 Copy   


  • RRID:Addgene_52987

http://www.addgene.org/52987

Species: Mus musculus
Genetic Insert: Lactaherin
Vector Backbone Description: Backbone Size:3648; Vector Backbone:pPD 49.83; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22727702

Proper citation: RRID:Addgene_52987 Copy   


http://www.addgene.org/52985

Species: Synthetic
Genetic Insert: nls-ha-MCP-VenusN-nls-ha-PCP-VenusC
Vector Backbone Description: Backbone Size:6200; Vector Backbone:phage; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24402470

Proper citation: RRID:Addgene_52985 Copy   


  • RRID:Addgene_52908

http://www.addgene.org/52908

Vector Backbone Description: Backbone Size:3506; Vector Backbone:pSLfa; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_52908 Copy   


  • RRID:Addgene_52909

http://www.addgene.org/52909

Species: Drosophila pseudoobscura
Genetic Insert: Drosophila pseudoobscura hsp82 promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4786; Vector Backbone:pGL3; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23549343

Proper citation: RRID:Addgene_52909 Copy   


http://www.addgene.org/52906

Species: Deinococcus radiodurans
Genetic Insert: Zipp.-L-IFP-F[2]+Venus
Vector Backbone Description: Backbone Marker:Addgene; Vector Backbone:pLpC; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24747815

Proper citation: RRID:Addgene_52906 Copy   


http://www.addgene.org/52907

Species: Deinococcus radiodurans
Genetic Insert: Zipp.-L-IFP-F[1]+Plum
Vector Backbone Description: Backbone Marker:Addgene; Vector Backbone:pLpC; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24747815

Proper citation: RRID:Addgene_52907 Copy   


  • RRID:Addgene_52904

    This resource has 1+ mentions.

http://www.addgene.org/52904

Vector Backbone Description: Backbone Size:5935; Vector Backbone:pMos3xP3DsRED; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20456509
Comments: attP site is gtagtgccccaactggggtaacctttgagttctctcagttgggggcgtag

Proper citation: RRID:Addgene_52904 Copy   


http://www.addgene.org/52905

Species: Homo sapiens
Genetic Insert: Cat-L-IFP-F[1]+Plum
Vector Backbone Description: Backbone Marker:Addgene; Vector Backbone:pLpC; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24747815

Proper citation: RRID:Addgene_52905 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X