Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Bacterial Resistance:ampicillin (facet)


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

328,858 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pShoHELIX-sgRNA_entry (BO3)
 
Resource Report
Resource Website
RRID:Addgene_181784 nAniI-ShoTnsB, ShoTnsC, ShoTniQ, ShoCas12k Synthetic Ampicillin PMID:36593413 Please visit https://www.biorxiv.org/content/10.1101/2022.01.07.475005v1 for bioRxiv preprint. Vector Backbone:pUC19; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin nAniI = K227M, F80K, L232K 2026-08-15 01:11:29 0
pAcCAST-sgRNA_entry (CJT83)
 
Resource Report
Resource Website
RRID:Addgene_181785 AcTnsB, AcTnsC, AcTniQ, AcCas12k Synthetic Ampicillin PMID:36593413 Please visit https://www.biorxiv.org/content/10.1101/2022.01.07.475005v1 for bioRxiv preprint. Vector Backbone:pUC19; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:11:29 0
psgRNA-2xMS2-lacO
 
Resource Report
Resource Website
RRID:Addgene_181909 sgRNA-2XMS2-lacO S.pyogenes, MS2 bacteriophage, E. coli Ampicillin PMID:32101700 Backbone Marker:Addgene; Backbone Size:3008; Vector Backbone:pU6_sgRNA-MS2-backbone; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:11:29 0
pAAV-shNCLX-1
 
Resource Report
Resource Website
RRID:Addgene_181870 solute carrier 8 family member B1 Mus musculus Ampicillin PMID:34942149 Vector Backbone:pAAV-U6_CaMKIIa-mCherry; Vector Types:Mammalian Expression, Mouse Targeting, Adenoviral, AAV; Bacterial Resistance:Ampicillin 2026-08-15 01:11:29 0
pET16-mHP1alpha
 
Resource Report
Resource Website
RRID:Addgene_181910 mHP1alpha Mus musculus Ampicillin PMID:32101700 Backbone Marker:Novagen; Backbone Size:5711; Vector Backbone:pET16b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:11:29 0
pLenti-CMV-NGLY1-Puro
 
Resource Report
Resource Website
RRID:Addgene_181916 N-glycanase 1 Homo sapiens Ampicillin PMID:35271393 Backbone Size:7915; Vector Backbone:pLenti-CMV-Puro-DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:11:29 0
pTRE3G-ZSGreen1-mHP1alpha
 
Resource Report
Resource Website
RRID:Addgene_181913 mHP1alpha Mus musculus Ampicillin PMID:32101700 Backbone Marker:Takara; Backbone Size:4700; Vector Backbone:pTRE3G-ZsGreen1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:11:29 0
MMLV-RT
 
Resource Report
Resource Website
RRID:Addgene_181801 MMLV-RT Ampicillin PMID:35379962 Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:11:29 0
U6-petRNA
 
Resource Report
Resource Website
RRID:Addgene_181802 petRNA-Kan Ampicillin PMID:35379962 Vector Backbone:U6; Vector Types:CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:11:29 0
Phage-PGK-Flag-HA-FKBP-T(G177D)
 
Resource Report
Resource Website
RRID:Addgene_181735 T (brachyury) Homo sapiens Ampicillin PMID:33521702 Vector Backbone:Phage-PGK-Flag-HA-FKBP-DEST; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin a silent mutation in the PAM site of an sgRNAt targeting enodgenous T (sg_T: CCCTGAGACCCAGTTCATAG) at amino acid 194 - C to T at position 3 of alanine. Also a G to A mutation at position 2 of Glycine 177. 2026-08-15 01:11:28 0
Phage-PGK-Flag-HA-FKBP-T(WT)
 
Resource Report
Resource Website
RRID:Addgene_181734 T (brachyury) Homo sapiens Ampicillin PMID:33521702 Vector Backbone:Phage-PGK-Flag-HA-FKBP-DEST; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin a silent mutation in the PAM site of an sgRNAt targeting enodgenous T (sg_T: CCCTGAGACCCAGTTCATAG) at amino acid 194 - C to T at position 3 of alanine 2026-08-15 01:11:28 0
pAAV-shMcu-2
 
Resource Report
Resource Website
RRID:Addgene_181867 mitochondrial calcium uniporter Mus musculus Ampicillin PMID:23774321 Vector Backbone:pAAV-U6_CAG-hrGFP; Vector Types:Mammalian Expression, Mouse Targeting, Adenoviral, AAV; Bacterial Resistance:Ampicillin 2026-08-15 01:11:29 0
pAAV-EF1α-DIO-CFL-SN
 
Resource Report
Resource Website
RRID:Addgene_181740 CFL-SN Homo sapiens Ampicillin PMID:34762472 As descried above, SN was developed by Dr. Takeharu Nagai (Osaka University). https://www.addgene.org/53234/ Backbone Marker:Stratagene; Backbone Size:5604; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin 2026-08-15 01:11:28 0
pAAV-EF1α-DIO-SN
 
Resource Report
Resource Website
RRID:Addgene_181741 SuperNova (monomeric photosensitizing fluorescent protein for chromophore-assisted light inactivation) Synthetic Ampicillin PMID:34762472 As descried above, SN was developed by Dr. Takeharu Nagai (Osaka University). https://www.addgene.org/53234/ Backbone Marker:Stratagene; Backbone Size:5604; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin 2026-08-15 01:11:28 0
psgRNA-2xMS2-mSAT
 
Resource Report
Resource Website
RRID:Addgene_181908 sgRNA-2XMS2-mSAT S.pyogenes, MS2 bacteriophage, M. musculus (mouse) Ampicillin PMID:32101700 Backbone Marker:Addgene; Backbone Size:3008; Vector Backbone:pU6_sgRNA-MS2-backbone; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:11:29 0
pAAV-shMcu-1
 
Resource Report
Resource Website
RRID:Addgene_181868 mitochondrial calcium uniporter Mus musculus Ampicillin PMID:23774321 Vector Backbone:pAAV-U6_CAG-hrGFP; Vector Types:Mammalian Expression, Mouse Targeting, Adenoviral, AAV; Bacterial Resistance:Ampicillin 2026-08-15 01:11:29 0
pShHELIX(Cas12k-TniQ-TniQ)-sgRNA_entry (CJT112)
 
Resource Report
Resource Website
RRID:Addgene_181791 nAniI-ShTnsB, ShTnsC, ShCas12k-ShTniQ-ShTniQ Synthetic Ampicillin PMID:36593413 Please visit https://www.biorxiv.org/content/10.1101/2022.01.07.475005v1 for bioRxiv preprint. Vector Backbone:pUC19; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin nAniI = K227M, F80K, L232K 2026-08-15 01:11:29 0
pShHELIX(Cas12k-TnsC)-sgRNA_entry (CJT113)
 
Resource Report
Resource Website
RRID:Addgene_181792 nAniI-ShTnsB, ShTniQ, ShCas12k-ShTnsC Synthetic Ampicillin PMID:36593413 Please visit https://www.biorxiv.org/content/10.1101/2022.01.07.475005v1 for bioRxiv preprint. Vector Backbone:pUC19; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin nAniI = K227M, F80K, L232K 2026-08-15 01:11:29 0
MCP-M-MLV-RT
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_181799 MCP-M-MLV-RT Ampicillin PMID:35379962 Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:11:29 1
PSD-95 scFv [K28/43]
 
Resource Report
Resource Website
RRID:Addgene_182066 recombinant mouse scFv targeting PSD-95 (Homo sapiens) Mus musculus Ampicillin PMID:37758930 This is a recombinant scFv derived from RRID: AB_2895566. Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:11:30 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.