Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pTwist Amp msTMEM115-TEV-3C-P2A-mScarlet-I HDR Template Resource Report Resource Website |
RRID:Addgene_215000 | msTMEM115-TEV-3C-P2A-mScarlet-I HDR Template | Mus musculus | Ampicillin | Use the following genomic target sequence: GGGACGGTCACCTTCCCTGGGGG ( final "GGG" is the PAM site) . Additional data, code, and other details related to this work (Hollingsworth et al. 2024) are available at https://harperlab.pubpub.org/pub/nlrp3/. | Vector Backbone:pTwist-Amp; Vector Types:HDR template; Bacterial Resistance:Ampicillin | 2026-08-15 01:29:24 | 0 | ||
|
OptoProfilin.S138A Resource Report Resource Website |
RRID:Addgene_208288 | Cry2 - mCherry - Profilin | Mus musculus | Kanamycin | PMID:38457348 | Please visit https://doi.org/10.1101/2023.10.04.560945 for bioRxiv preprint. | Backbone Marker:Clontech; Backbone Size:4018; Vector Backbone:mCherry N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | Ser 138 (sometimes numbered 137) mutated to Ala | 2026-08-15 01:29:25 | 0 |
|
Anti-KChIP4 K+ channel [N423/42R] Resource Report Resource Website |
RRID:Addgene_222163 | Anti-KChIP4 K+ channel (Homo sapiens) recombinant mouse monoclonal antibody. | Mus musculus | Ampicillin | PMID:37758930 | RRID: AB_3099611. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute. | Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:30:30 | 0 | |
|
Anti-TMEM240 [N498/78R] Resource Report Resource Website |
RRID:Addgene_222166 | Anti-TMEM240 (Homo sapiens) recombinant mouse monoclonal antibody. | Mus musculus | Ampicillin | PMID:37758930 | RRID: AB_3099613. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute. | Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:30:30 | 0 | |
|
Anti-VAPA [N479/24R] Resource Report Resource Website |
RRID:Addgene_222165 | Anti-VAPA (Rattus norvegicus) recombinant mouse monoclonal antibody. | Mus musculus | Ampicillin | PMID:37758930 | RRID: AB_3099593. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute. | Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:30:30 | 0 | |
|
Anti-Beclin-1 [N248A/15R] Resource Report Resource Website |
RRID:Addgene_222160 | Anti-Beclin-1 (Mus musculus) recombinant mouse monoclonal antibody. | Mus musculus | Ampicillin | PMID:37758930 | RRID: AB_3099608. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute. | Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:30:30 | 0 | |
|
Anti-Beclin-1 [N248A/27R] Resource Report Resource Website |
RRID:Addgene_222162 | Anti-Beclin-1 (Mus musculus) recombinant mouse monoclonal antibody. | Mus musculus | Ampicillin | PMID:37758930 | RRID: AB_3099610. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute. | Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:30:30 | 0 | |
|
Anti-CASK [K56A/50R-2b] Resource Report Resource Website |
RRID:Addgene_222168 | Anti-CASK (Homo sapiens) recombinant mouse monoclonal antibody. | Mus musculus | Ampicillin | PMID:37758930 | RRID: AB_3099615. Isotype: IgG2b. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute. | Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2b; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:30:30 | 0 | |
|
Anti-GluN2B/NR2B glutamate receptor [N59/17R] Resource Report Resource Website |
RRID:Addgene_222167 | Anti-GluN2B/NR2B glutamate receptor (Rattus norvegicus) recombinant mouse monoclonal antibody. | Mus musculus | Ampicillin | PMID:37758930 | RRID: AB_3099614. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute. | Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:30:30 | 0 | |
|
Anti-TARPGamma2/4/8 [N245/36R-2b] Resource Report Resource Website |
RRID:Addgene_220426 | Anti-TARPGamma2/4/8 (Rattus norvegicus) recombinant mouse monoclonal antibody. | Mus musculus | Ampicillin | PMID:37758930 | RRID: AB_3096473. Isotype: IgG2b. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute. | Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2b; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:30:29 | 0 | |
|
Anti-Synaptotagmin-7 [N275/14R-2b] Resource Report Resource Website |
RRID:Addgene_220428 | Anti-Synaptotagmin-7 (Mus musculus) recombinant mouse monoclonal antibody. | Mus musculus | Ampicillin | PMID:37758930 | RRID: AB_3096475. Isotype: IgG2b. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute. | Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2b; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:30:29 | 0 | |
|
Anti-HCN3 [N141/16R] Resource Report Resource Website |
RRID:Addgene_222152 | Anti-HCN3 (Mus musculus) recombinant mouse monoclonal antibody. | Mus musculus | Ampicillin | PMID:37758930 | RRID: AB_3099600. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute. | Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:30:30 | 0 | |
|
Anti-Gamma-protocadherin-B2 [N148/14R] Resource Report Resource Website |
RRID:Addgene_222155 | Anti-Gamma-protocadherin-B2 (Mus musculus) recombinant mouse monoclonal antibody. | Mus musculus | Ampicillin | PMID:37758930 | RRID: AB_3099603. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute. | Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:30:30 | 0 | |
|
Anti-Aldh1l1 [N103/39R] Resource Report Resource Website |
RRID:Addgene_222151 | Anti-Aldh1l1 (Rattus norvegicus) recombinant mouse monoclonal antibody. | Mus musculus | Ampicillin | PMID:37758930 | RRID: AB_2750697. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute. | Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:30:30 | 0 | |
|
Anti-Dopamine D2 receptor [N186/26R] Resource Report Resource Website |
RRID:Addgene_222156 | Anti-Dopamine D2 receptor (Rattus norvegicus) recombinant mouse monoclonal antibody. | Mus musculus | Ampicillin | PMID:37758930 | RRID: AB_3099604. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute. | Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:30:30 | 0 | |
|
Anti-VDAC1 [N152B/23R-2b] Resource Report Resource Website |
RRID:Addgene_222171 | Anti-VDAC1 (Homo sapiens) recombinant mouse monoclonal antibody. | Mus musculus | Ampicillin | PMID:37758930 | RRID: AB_3099618. Isotype: IgG2b. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute. | Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2b; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:30:30 | 0 | |
|
Anti-Beta4-spectrin [N393/2R-2b] Resource Report Resource Website |
RRID:Addgene_222173 | Anti-Beta4-spectrin (Homo sapiens) recombinant mouse monoclonal antibody. | Mus musculus | Ampicillin | PMID:37758930 | RRID: AB_3099620. Isotype: IgG2b. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute. | Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2b; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:30:30 | 0 | |
|
Anti-Lgi1 [N283/7R-2b] Resource Report Resource Website |
RRID:Addgene_222172 | Anti-Lgi1 (Mus musculus) recombinant mouse monoclonal antibody. | Mus musculus | Ampicillin | PMID:37758930 | RRID: AB_3099619. Isotype: IgG2b. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute. | Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2b; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:30:30 | 0 | |
|
Anti-GluN2C/NR2C [N422/18R-2b] Resource Report Resource Website |
RRID:Addgene_220433 | Anti-GluN2C/NR2C (Rattus norvegicus) recombinant mouse monoclonal antibody. | Mus musculus | Ampicillin | PMID:37758930 | RRID: AB_3096480. Isotype: IgG2b. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute. | Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2b; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:30:29 | 0 | |
|
Anti-Kv7.1/KCNQ1 K+ channel [N37A/10R-2b] Resource Report Resource Website |
RRID:Addgene_220431 | Anti-Kv7.1/KCNQ1 K+ channel (Homo sapiens) recombinant mouse monoclonal antibody. | Mus musculus | Ampicillin | PMID:37758930 | RRID: AB_3096478. Isotype: IgG2b. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute. | Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2b; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:30:29 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.