Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Organism:mus musculus (facet)


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

12,972 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pTwist Amp msTMEM115-TEV-3C-P2A-mScarlet-I HDR Template
 
Resource Report
Resource Website
RRID:Addgene_215000 msTMEM115-TEV-3C-P2A-mScarlet-I HDR Template Mus musculus Ampicillin Use the following genomic target sequence: GGGACGGTCACCTTCCCTGGGGG ( final "GGG" is the PAM site) . Additional data, code, and other details related to this work (Hollingsworth et al. 2024) are available at https://harperlab.pubpub.org/pub/nlrp3/. Vector Backbone:pTwist-Amp; Vector Types:HDR template; Bacterial Resistance:Ampicillin 2026-08-15 01:29:24 0
OptoProfilin.S138A
 
Resource Report
Resource Website
RRID:Addgene_208288 Cry2 - mCherry - Profilin Mus musculus Kanamycin PMID:38457348 Please visit https://doi.org/10.1101/2023.10.04.560945 for bioRxiv preprint. Backbone Marker:Clontech; Backbone Size:4018; Vector Backbone:mCherry N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin Ser 138 (sometimes numbered 137) mutated to Ala 2026-08-15 01:29:25 0
Anti-KChIP4 K+ channel [N423/42R]
 
Resource Report
Resource Website
RRID:Addgene_222163 Anti-KChIP4 K+ channel (Homo sapiens) recombinant mouse monoclonal antibody. Mus musculus Ampicillin PMID:37758930 RRID: AB_3099611. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute. Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:30:30 0
Anti-TMEM240 [N498/78R]
 
Resource Report
Resource Website
RRID:Addgene_222166 Anti-TMEM240 (Homo sapiens) recombinant mouse monoclonal antibody. Mus musculus Ampicillin PMID:37758930 RRID: AB_3099613. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute. Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:30:30 0
Anti-VAPA [N479/24R]
 
Resource Report
Resource Website
RRID:Addgene_222165 Anti-VAPA (Rattus norvegicus) recombinant mouse monoclonal antibody. Mus musculus Ampicillin PMID:37758930 RRID: AB_3099593. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute. Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:30:30 0
Anti-Beclin-1 [N248A/15R]
 
Resource Report
Resource Website
RRID:Addgene_222160 Anti-Beclin-1 (Mus musculus) recombinant mouse monoclonal antibody. Mus musculus Ampicillin PMID:37758930 RRID: AB_3099608. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute. Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:30:30 0
Anti-Beclin-1 [N248A/27R]
 
Resource Report
Resource Website
RRID:Addgene_222162 Anti-Beclin-1 (Mus musculus) recombinant mouse monoclonal antibody. Mus musculus Ampicillin PMID:37758930 RRID: AB_3099610. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute. Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:30:30 0
Anti-CASK [K56A/50R-2b]
 
Resource Report
Resource Website
RRID:Addgene_222168 Anti-CASK (Homo sapiens) recombinant mouse monoclonal antibody. Mus musculus Ampicillin PMID:37758930 RRID: AB_3099615. Isotype: IgG2b. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute. Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2b; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:30:30 0
Anti-GluN2B/NR2B glutamate receptor [N59/17R]
 
Resource Report
Resource Website
RRID:Addgene_222167 Anti-GluN2B/NR2B glutamate receptor (Rattus norvegicus) recombinant mouse monoclonal antibody. Mus musculus Ampicillin PMID:37758930 RRID: AB_3099614. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute. Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:30:30 0
Anti-TARPGamma2/4/8 [N245/36R-2b]
 
Resource Report
Resource Website
RRID:Addgene_220426 Anti-TARPGamma2/4/8 (Rattus norvegicus) recombinant mouse monoclonal antibody. Mus musculus Ampicillin PMID:37758930 RRID: AB_3096473. Isotype: IgG2b. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute. Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2b; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:30:29 0
Anti-Synaptotagmin-7 [N275/14R-2b]
 
Resource Report
Resource Website
RRID:Addgene_220428 Anti-Synaptotagmin-7 (Mus musculus) recombinant mouse monoclonal antibody. Mus musculus Ampicillin PMID:37758930 RRID: AB_3096475. Isotype: IgG2b. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute. Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2b; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:30:29 0
Anti-HCN3 [N141/16R]
 
Resource Report
Resource Website
RRID:Addgene_222152 Anti-HCN3 (Mus musculus) recombinant mouse monoclonal antibody. Mus musculus Ampicillin PMID:37758930 RRID: AB_3099600. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute. Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:30:30 0
Anti-Gamma-protocadherin-B2 [N148/14R]
 
Resource Report
Resource Website
RRID:Addgene_222155 Anti-Gamma-protocadherin-B2 (Mus musculus) recombinant mouse monoclonal antibody. Mus musculus Ampicillin PMID:37758930 RRID: AB_3099603. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute. Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:30:30 0
Anti-Aldh1l1 [N103/39R]
 
Resource Report
Resource Website
RRID:Addgene_222151 Anti-Aldh1l1 (Rattus norvegicus) recombinant mouse monoclonal antibody. Mus musculus Ampicillin PMID:37758930 RRID: AB_2750697. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute. Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:30:30 0
Anti-Dopamine D2 receptor [N186/26R]
 
Resource Report
Resource Website
RRID:Addgene_222156 Anti-Dopamine D2 receptor (Rattus norvegicus) recombinant mouse monoclonal antibody. Mus musculus Ampicillin PMID:37758930 RRID: AB_3099604. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute. Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:30:30 0
Anti-VDAC1 [N152B/23R-2b]
 
Resource Report
Resource Website
RRID:Addgene_222171 Anti-VDAC1 (Homo sapiens) recombinant mouse monoclonal antibody. Mus musculus Ampicillin PMID:37758930 RRID: AB_3099618. Isotype: IgG2b. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute. Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2b; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:30:30 0
Anti-Beta4-spectrin [N393/2R-2b]
 
Resource Report
Resource Website
RRID:Addgene_222173 Anti-Beta4-spectrin (Homo sapiens) recombinant mouse monoclonal antibody. Mus musculus Ampicillin PMID:37758930 RRID: AB_3099620. Isotype: IgG2b. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute. Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2b; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:30:30 0
Anti-Lgi1 [N283/7R-2b]
 
Resource Report
Resource Website
RRID:Addgene_222172 Anti-Lgi1 (Mus musculus) recombinant mouse monoclonal antibody. Mus musculus Ampicillin PMID:37758930 RRID: AB_3099619. Isotype: IgG2b. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute. Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2b; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:30:30 0
Anti-GluN2C/NR2C [N422/18R-2b]
 
Resource Report
Resource Website
RRID:Addgene_220433 Anti-GluN2C/NR2C (Rattus norvegicus) recombinant mouse monoclonal antibody. Mus musculus Ampicillin PMID:37758930 RRID: AB_3096480. Isotype: IgG2b. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute. Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2b; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:30:29 0
Anti-Kv7.1/KCNQ1 K+ channel [N37A/10R-2b]
 
Resource Report
Resource Website
RRID:Addgene_220431 Anti-Kv7.1/KCNQ1 K+ channel (Homo sapiens) recombinant mouse monoclonal antibody. Mus musculus Ampicillin PMID:37758930 RRID: AB_3096478. Isotype: IgG2b. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute. Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2b; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:30:29 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.