Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: msTMEM115-TEV-3C-P2A-mScarlet-I HDR Template
Vector Backbone Description: Vector Backbone:pTwist-Amp; Vector Types:HDR template; Bacterial Resistance:Ampicillin
Comments: Use the following genomic target sequence: GGGACGGTCACCTTCCCTGGGGG ( final "GGG" is the PAM site) . Additional data, code, and other details related to this work (Hollingsworth et al. 2024) are available at https://harperlab.pubpub.org/pub/nlrp3/.
Proper citation: RRID:Addgene_215000 Copy
Species: Mus musculus
Genetic Insert: Cry2 - mCherry - Profilin
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4018; Vector Backbone:mCherry N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:38457348
Comments: Please visit https://doi.org/10.1101/2023.10.04.560945 for bioRxiv preprint.
Proper citation: RRID:Addgene_208288 Copy
Species: Mus musculus
Genetic Insert: Anti-KChIP4 K+ channel (Homo sapiens) recombinant mouse monoclonal antibody.
Vector Backbone Description: Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37758930
Comments: RRID: AB_3099611. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute.
Proper citation: RRID:Addgene_222163 Copy
Species: Mus musculus
Genetic Insert: Anti-TMEM240 (Homo sapiens) recombinant mouse monoclonal antibody.
Vector Backbone Description: Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37758930
Comments: RRID: AB_3099613. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute.
Proper citation: RRID:Addgene_222166 Copy
Species: Mus musculus
Genetic Insert: Anti-VAPA (Rattus norvegicus) recombinant mouse monoclonal antibody.
Vector Backbone Description: Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37758930
Comments: RRID: AB_3099593. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute.
Proper citation: RRID:Addgene_222165 Copy
Species: Mus musculus
Genetic Insert: Anti-Beclin-1 (Mus musculus) recombinant mouse monoclonal antibody.
Vector Backbone Description: Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37758930
Comments: RRID: AB_3099608. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute.
Proper citation: RRID:Addgene_222160 Copy
Species: Mus musculus
Genetic Insert: Anti-Beclin-1 (Mus musculus) recombinant mouse monoclonal antibody.
Vector Backbone Description: Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37758930
Comments: RRID: AB_3099610. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute.
Proper citation: RRID:Addgene_222162 Copy
Species: Mus musculus
Genetic Insert: Anti-CASK (Homo sapiens) recombinant mouse monoclonal antibody.
Vector Backbone Description: Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2b; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37758930
Comments: RRID: AB_3099615. Isotype: IgG2b. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute.
Proper citation: RRID:Addgene_222168 Copy
Species: Mus musculus
Genetic Insert: Anti-GluN2B/NR2B glutamate receptor (Rattus norvegicus) recombinant mouse monoclonal antibody.
Vector Backbone Description: Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37758930
Comments: RRID: AB_3099614. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute.
Proper citation: RRID:Addgene_222167 Copy
Species: Mus musculus
Genetic Insert: Anti-TARPGamma2/4/8 (Rattus norvegicus) recombinant mouse monoclonal antibody.
Vector Backbone Description: Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2b; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37758930
Comments: RRID: AB_3096473. Isotype: IgG2b. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute.
Proper citation: RRID:Addgene_220426 Copy
Species: Mus musculus
Genetic Insert: Anti-Synaptotagmin-7 (Mus musculus) recombinant mouse monoclonal antibody.
Vector Backbone Description: Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2b; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37758930
Comments: RRID: AB_3096475. Isotype: IgG2b. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute.
Proper citation: RRID:Addgene_220428 Copy
Species: Mus musculus
Genetic Insert: Anti-HCN3 (Mus musculus) recombinant mouse monoclonal antibody.
Vector Backbone Description: Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37758930
Comments: RRID: AB_3099600. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute.
Proper citation: RRID:Addgene_222152 Copy
Species: Mus musculus
Genetic Insert: Anti-Gamma-protocadherin-B2 (Mus musculus) recombinant mouse monoclonal antibody.
Vector Backbone Description: Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37758930
Comments: RRID: AB_3099603. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute.
Proper citation: RRID:Addgene_222155 Copy
Species: Mus musculus
Genetic Insert: Anti-Aldh1l1 (Rattus norvegicus) recombinant mouse monoclonal antibody.
Vector Backbone Description: Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37758930
Comments: RRID: AB_2750697. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute.
Proper citation: RRID:Addgene_222151 Copy
Species: Mus musculus
Genetic Insert: Anti-Dopamine D2 receptor (Rattus norvegicus) recombinant mouse monoclonal antibody.
Vector Backbone Description: Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37758930
Comments: RRID: AB_3099604. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute.
Proper citation: RRID:Addgene_222156 Copy
Species: Mus musculus
Genetic Insert: Anti-VDAC1 (Homo sapiens) recombinant mouse monoclonal antibody.
Vector Backbone Description: Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2b; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37758930
Comments: RRID: AB_3099618. Isotype: IgG2b. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute.
Proper citation: RRID:Addgene_222171 Copy
Species: Mus musculus
Genetic Insert: Anti-Beta4-spectrin (Homo sapiens) recombinant mouse monoclonal antibody.
Vector Backbone Description: Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2b; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37758930
Comments: RRID: AB_3099620. Isotype: IgG2b. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute.
Proper citation: RRID:Addgene_222173 Copy
Species: Mus musculus
Genetic Insert: Anti-Lgi1 (Mus musculus) recombinant mouse monoclonal antibody.
Vector Backbone Description: Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2b; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37758930
Comments: RRID: AB_3099619. Isotype: IgG2b. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute.
Proper citation: RRID:Addgene_222172 Copy
Species: Mus musculus
Genetic Insert: Anti-GluN2C/NR2C (Rattus norvegicus) recombinant mouse monoclonal antibody.
Vector Backbone Description: Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2b; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37758930
Comments: RRID: AB_3096480. Isotype: IgG2b. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute.
Proper citation: RRID:Addgene_220433 Copy
Species: Mus musculus
Genetic Insert: Anti-Kv7.1/KCNQ1 K+ channel (Homo sapiens) recombinant mouse monoclonal antibody.
Vector Backbone Description: Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2b; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37758930
Comments: RRID: AB_3096478. Isotype: IgG2b. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute.
Proper citation: RRID:Addgene_220431 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.