Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: INCENP d543-746
Vector Backbone Description: Backbone Size:5100; Vector Backbone:pcDNA5-FRT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26166576
Proper citation: RRID:Addgene_108503 Copy
Species: Homo sapiens
Genetic Insert: INCENP
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pCR3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26166576
Comments: Compared to the NCBI reference sequence NM_001040694, this plasmid contains small, in-frame insertions in INCENP after aa 543 and aa 746. These insertions are extra restriction sites for cloning.
Proper citation: RRID:Addgene_108501 Copy
Species: Homo sapiens
Genetic Insert: INCENP d543-746iPRC1 304-509
Vector Backbone Description: Backbone Size:5100; Vector Backbone:pcDNA4-TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26166576
Proper citation: RRID:Addgene_108500 Copy
Species: Homo sapiens
Genetic Insert: CEN-Box of INCENP
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pEGFP-N2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26166576
Proper citation: RRID:Addgene_108509 Copy
Species: Homo sapiens
Genetic Insert: CEN-Box of INCENP
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pEGFP-N2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26166576
Proper citation: RRID:Addgene_108508 Copy
Species: Homo sapiens
Genetic Insert: CEN-Box of INCENP
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pEGFP-N2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26166576
Proper citation: RRID:Addgene_108507 Copy
Species: Homo sapiens
Genetic Insert: INCENP
Vector Backbone Description: Backbone Size:5100; Vector Backbone:pcDNA5-FRT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26166576
Comments: Compared to the NCBI reference sequence NM_001040694, this plasmid contains small, in-frame insertions in INCENP after aa 543 and aa 746. These insertions are extra restriction sites for cloning.
Proper citation: RRID:Addgene_108506 Copy
Species: Homo sapiens
Genetic Insert: INCENP
Vector Backbone Description: Backbone Size:5100; Vector Backbone:pcDNA5-FRT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26166576
Comments: Compared to the NCBI reference sequence NM_001040694, this plasmid contains small, in-frame insertions in INCENP after aa 543 and aa 746. These insertions are extra restriction sites for cloning.
Proper citation: RRID:Addgene_108505 Copy
Species: Homo sapiens
Genetic Insert: Mis12-dCEN-INCENP
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pCR3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19150808
Proper citation: RRID:Addgene_108477 Copy
Species: Homo sapiens
Genetic Insert: BAP1
Vector Backbone Description: Backbone Marker:Dr. J. Mirkovitch, Swiss Institute for Experimental Cancer Research, Epalinges, Switzerland; Backbone Size:5224; Vector Backbone:pCI-puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31619462
Proper citation: RRID:Addgene_108439 Copy
Species: Homo sapiens
Genetic Insert: PCDH7 transcript variant b
Vector Backbone Description: Backbone Marker:David Root Lab, addgene #25890; Backbone Size:9377; Vector Backbone:pLX304; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27821484
Comments: Full-length cDNA of PCDH7 transcript variant b, including the stop codon, was cloned into pLX304 vector (Addgene, #25890) to generate this construct. Therefore, although pLX304 has a downstream V5 tag coding sequence, the PCDH7 transcript variant b is NOT expressed as V5-tagged protein.
Proper citation: RRID:Addgene_108539 Copy
Species: Homo sapiens
Genetic Insert: PTBP1 isoform 4
Vector Backbone Description: Backbone Marker:GE Healthcare Life Sciences; Backbone Size:4969; Vector Backbone:pGEX4T1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25599992
Comments: For expression of recombinant protein use E.coli BL21. GST tag can be cleaved with Thrombin
Proper citation: RRID:Addgene_108594 Copy
Species: Homo sapiens
Genetic Insert: protein kinase A, catalytic subunit
Vector Backbone Description: Backbone Marker:Genlantis; Backbone Size:3909; Vector Backbone:phCMV-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29928581
Proper citation: RRID:Addgene_108588 Copy
Species: Homo sapiens
Genetic Insert: HHR23A
Vector Backbone Description: Backbone Marker:Amersham; Backbone Size:4970; Vector Backbone:pGEX-4T2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10373495
Comments: See author's map.
Proper citation: RRID:Addgene_10864 Copy
Species: Homo sapiens
Genetic Insert: RNASEH2B
Vector Backbone Description: Backbone Marker:Amersham; Backbone Size:4984; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21177854
Proper citation: RRID:Addgene_108693 Copy
Species: Homo sapiens
Genetic Insert: PCDH7 transcript variant d
Vector Backbone Description: Backbone Marker:David Root Lab, addgene #25897; Backbone Size:9335; Vector Backbone:pLX303; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27821484
Proper citation: RRID:Addgene_108541 Copy
Species: Homo sapiens
Genetic Insert: p53
Vector Backbone Description: Backbone Size:2870; Vector Backbone:pGEM4; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2157286
Comments: See author's map. Good for in vitro expression.
Proper citation: RRID:Addgene_10853 Copy
Species: Homo sapiens
Genetic Insert: eGFP-cGAS
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:6264; Vector Backbone:pMSCVpuro; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28738408
Proper citation: RRID:Addgene_108674 Copy
Species: Homo sapiens
Genetic Insert: E6-AP
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:2865; Vector Backbone:pGEM-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8393140
Comments: See author's map.
Proper citation: RRID:Addgene_10857 Copy
Species: Homo sapiens
Genetic Insert: hsa-miR-212-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.
Proper citation: RRID:Addgene_103352 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
