Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pAWP78 Resource Report Resource Website 1+ mentions |
RRID:Addgene_61263 | Kanamycin | PMID:25548049 | In order to use plasmid pAWP78, inserts should be added by Gibson Cloning. Primers to amplify the backbone have been annotated on the depositor's plasmid map. The sequences are (5' to 3'): AP259_pAWP78_fwd1 - TTGTCGGGAAGATGCGTGAT AP254_pAWP78_rev1 - CAGCTCACTCAAAGGCGGTA | Backbone Size:4979; Vector Backbone:pCM66; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin | 2026-08-15 01:17:40 | 2 | |||
|
pCri-14b Resource Report Resource Website |
RRID:Addgene_61335 | Green fluorescent protein | Kanamycin | PMID:25386923 | Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:17:41 | 0 | |||
|
pCri-11b Resource Report Resource Website |
RRID:Addgene_61333 | Green fluorescent protein | Kanamycin | PMID:25386923 | Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:17:41 | 0 | |||
|
pCri-9a-Strep Resource Report Resource Website |
RRID:Addgene_61341 | Green fluorescent protein | Kanamycin | PMID:25386923 | Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:17:41 | 0 | |||
|
pCri-8a-Strep Resource Report Resource Website |
RRID:Addgene_61340 | Green fluorescent protein | Kanamycin | PMID:25386923 | Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:17:41 | 0 | |||
|
pNeuroD-ires-GFP Resource Report Resource Website 10+ mentions |
RRID:Addgene_61403 | Kanamycin | PMID:19737524 | Backbone Size:6911; Vector Backbone:pNeuroD-Ires-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:17:41 | 10 | ||||
|
pOPINK-OTUD1 (full-length, aa 1-481) Resource Report Resource Website 1+ mentions |
RRID:Addgene_61405 | OTUD1 | Homo sapiens | Kanamycin | PMID:23827681 | Backbone Marker:OPPF-UK; Backbone Size:6299; Vector Backbone:pOPINK; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:17:41 | 2 | ||
|
pOPINK-OTUD1 (OTU+UIM, aa 287-481) Resource Report Resource Website 1+ mentions |
RRID:Addgene_61406 | OTUD1 | Homo sapiens | Kanamycin | PMID:23827681 | Hospenthal MK, Mevissen TET, Komander D. Nature Protoc. 2015 Jan 29;10:349-361. doi:10.1038/nprot.2015.018 | Backbone Marker:OPPF-UK; Backbone Size:6299; Vector Backbone:pOPINK; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | Deleted aa 1-286. | 2026-08-15 01:17:41 | 1 |
|
pOPINK-OTUD2 (full-length, aa 1-348) Resource Report Resource Website |
RRID:Addgene_61409 | OTUD2 | Homo sapiens | Kanamycin | PMID:23827681 | Hospenthal MK, Mevissen TET, Komander D. Nature Protoc. 2015 Jan 29;10:349-361. doi:10.1038/nprot.2015.018 | Backbone Marker:OPPF-UK; Backbone Size:6299; Vector Backbone:pOPINK; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:17:41 | 0 | |
|
pOPINK-ALG13 (OTU, aa 216-353) Resource Report Resource Website |
RRID:Addgene_61414 | ALG13 (Putative bifunctional UDP-N-acetylglucosamine transferase and deubiquitinase ALG13) | Homo sapiens | Kanamycin | PMID:23827681 | Backbone Marker:OPPF-UK; Backbone Size:6299; Vector Backbone:pOPINK; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | Deleted aa 1-215 and aa 354-1137. | 2026-08-15 01:17:41 | 0 | |
|
pME-QS (L1-L2) Resource Report Resource Website |
RRID:Addgene_61378 | QS | Kanamycin | PMID:23792917 | Discrepancies between full sequence and Addgene's QC results have no functional consequence. | Backbone Marker:Life Technologies ; Backbone Size:2555; Vector Backbone:pDONR221; Vector Types:; Bacterial Resistance:Kanamycin | 2026-08-15 01:17:41 | 0 | ||
|
pOPINK-OTUD6A (full-length, aa 1-288) Resource Report Resource Website |
RRID:Addgene_61416 | OTUD6A | Homo sapiens | Kanamycin | PMID:23827681 | Backbone Marker:OPPF-UK; Backbone Size:6299; Vector Backbone:pOPINK; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:17:42 | 0 | ||
|
pOPINK-OTUD3 (OTU, aa 52-209) Resource Report Resource Website |
RRID:Addgene_61412 | OTUD3 | Homo sapiens | Kanamycin | PMID:23827681 | Hospenthal MK, Mevissen TET, Komander D. Nature Protoc. 2015 Jan 29;10:349-361. doi:10.1038/nprot.2015.018 | Backbone Marker:OPPF-UK; Backbone Size:6299; Vector Backbone:pOPINK; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | Deleted aa 1-51 and aa 210-398. | 2026-08-15 01:17:41 | 0 |
|
pME-QF Resource Report Resource Website |
RRID:Addgene_61375 | QF | Neurospora | Kanamycin | PMID:23792917 | Backbone Marker:Life Technologies; Backbone Size:2564; Vector Backbone:pDONR221; Vector Types:; Bacterial Resistance:Kanamycin | 2026-08-15 01:17:41 | 0 | ||
|
pCri-4a Resource Report Resource Website 1+ mentions |
RRID:Addgene_61314 | Green fluorescent protein | Kanamycin | PMID:25386923 | Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:17:41 | 1 | |||
|
pmCherry_C1 I3(resist) Resource Report Resource Website |
RRID:Addgene_61399 | Inhibitor-3 | Homo sapiens | Kanamycin | PMID:25298395 | resistant against siRNA oligomer I3 S2 (CUGCUGTAUUUAUGAGAAA) | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP_C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | silent mutations of bases C183T T192C T189C | 2026-08-15 01:17:41 | 0 |
|
pCri-9a Resource Report Resource Website |
RRID:Addgene_61318 | Green fluorescent protein | Kanamycin | PMID:25386923 | Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:17:40 | 0 | |||
|
pCri-6a Resource Report Resource Website |
RRID:Addgene_61315 | Green fluorescent protein | Kanamycin | PMID:25386923 | Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:17:40 | 0 | |||
|
pCri-11a Resource Report Resource Website 1+ mentions |
RRID:Addgene_61319 | Green fluorescent protein | Kanamycin | PMID:25386923 | Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:17:40 | 1 | |||
|
pCri-6b Resource Report Resource Website |
RRID:Addgene_61329 | Green fluorescent protein | Kanamycin | PMID:25386923 | Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:17:41 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.