Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Bacterial Resistance:kanamycin (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

33,912 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pAWP78
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_61263 Kanamycin PMID:25548049 In order to use plasmid pAWP78, inserts should be added by Gibson Cloning. Primers to amplify the backbone have been annotated on the depositor's plasmid map. The sequences are (5' to 3'): AP259_pAWP78_fwd1 - TTGTCGGGAAGATGCGTGAT AP254_pAWP78_rev1 - CAGCTCACTCAAAGGCGGTA Backbone Size:4979; Vector Backbone:pCM66; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-15 01:17:40 2
pCri-14b
 
Resource Report
Resource Website 		RRID:Addgene_61335 Green fluorescent protein Kanamycin PMID:25386923 Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:17:41 0
pCri-11b
 
Resource Report
Resource Website 		RRID:Addgene_61333 Green fluorescent protein Kanamycin PMID:25386923 Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:17:41 0
pCri-9a-Strep
 
Resource Report
Resource Website 		RRID:Addgene_61341 Green fluorescent protein Kanamycin PMID:25386923 Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:17:41 0
pCri-8a-Strep
 
Resource Report
Resource Website 		RRID:Addgene_61340 Green fluorescent protein Kanamycin PMID:25386923 Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:17:41 0
pNeuroD-ires-GFP
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_61403 Kanamycin PMID:19737524 Backbone Size:6911; Vector Backbone:pNeuroD-Ires-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:17:41 10
pOPINK-OTUD1 (full-length, aa 1-481)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_61405 OTUD1 Homo sapiens Kanamycin PMID:23827681 Backbone Marker:OPPF-UK; Backbone Size:6299; Vector Backbone:pOPINK; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:17:41 2
pOPINK-OTUD1 (OTU+UIM, aa 287-481)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_61406 OTUD1 Homo sapiens Kanamycin PMID:23827681 Hospenthal MK, Mevissen TET, Komander D. Nature Protoc. 2015 Jan 29;10:349-361. doi:10.1038/nprot.2015.018 Backbone Marker:OPPF-UK; Backbone Size:6299; Vector Backbone:pOPINK; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin Deleted aa 1-286. 2026-08-15 01:17:41 1
pOPINK-OTUD2 (full-length, aa 1-348)
 
Resource Report
Resource Website 		RRID:Addgene_61409 OTUD2 Homo sapiens Kanamycin PMID:23827681 Hospenthal MK, Mevissen TET, Komander D. Nature Protoc. 2015 Jan 29;10:349-361. doi:10.1038/nprot.2015.018 Backbone Marker:OPPF-UK; Backbone Size:6299; Vector Backbone:pOPINK; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:17:41 0
pOPINK-ALG13 (OTU, aa 216-353)
 
Resource Report
Resource Website 		RRID:Addgene_61414 ALG13 (Putative bifunctional UDP-N-acetylglucosamine transferase and deubiquitinase ALG13) Homo sapiens Kanamycin PMID:23827681 Backbone Marker:OPPF-UK; Backbone Size:6299; Vector Backbone:pOPINK; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin Deleted aa 1-215 and aa 354-1137. 2026-08-15 01:17:41 0
pME-QS (L1-L2)
 
Resource Report
Resource Website 		RRID:Addgene_61378 QS Kanamycin PMID:23792917 Discrepancies between full sequence and Addgene's QC results have no functional consequence. Backbone Marker:Life Technologies ; Backbone Size:2555; Vector Backbone:pDONR221; Vector Types:; Bacterial Resistance:Kanamycin 2026-08-15 01:17:41 0
pOPINK-OTUD6A (full-length, aa 1-288)
 
Resource Report
Resource Website 		RRID:Addgene_61416 OTUD6A Homo sapiens Kanamycin PMID:23827681 Backbone Marker:OPPF-UK; Backbone Size:6299; Vector Backbone:pOPINK; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:17:42 0
pOPINK-OTUD3 (OTU, aa 52-209)
 
Resource Report
Resource Website 		RRID:Addgene_61412 OTUD3 Homo sapiens Kanamycin PMID:23827681 Hospenthal MK, Mevissen TET, Komander D. Nature Protoc. 2015 Jan 29;10:349-361. doi:10.1038/nprot.2015.018 Backbone Marker:OPPF-UK; Backbone Size:6299; Vector Backbone:pOPINK; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin Deleted aa 1-51 and aa 210-398. 2026-08-15 01:17:41 0
pME-QF
 
Resource Report
Resource Website 		RRID:Addgene_61375 QF Neurospora Kanamycin PMID:23792917 Backbone Marker:Life Technologies; Backbone Size:2564; Vector Backbone:pDONR221; Vector Types:; Bacterial Resistance:Kanamycin 2026-08-15 01:17:41 0
pCri-4a
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_61314 Green fluorescent protein Kanamycin PMID:25386923 Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:17:41 1
pmCherry_C1 I3(resist)
 
Resource Report
Resource Website 		RRID:Addgene_61399 Inhibitor-3 Homo sapiens Kanamycin PMID:25298395 resistant against siRNA oligomer I3 S2 (CUGCUGTAUUUAUGAGAAA) Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP_C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin silent mutations of bases C183T T192C T189C 2026-08-15 01:17:41 0
pCri-9a
 
Resource Report
Resource Website 		RRID:Addgene_61318 Green fluorescent protein Kanamycin PMID:25386923 Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:17:40 0
pCri-6a
 
Resource Report
Resource Website 		RRID:Addgene_61315 Green fluorescent protein Kanamycin PMID:25386923 Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:17:40 0
pCri-11a
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_61319 Green fluorescent protein Kanamycin PMID:25386923 Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:17:40 1
pCri-6b
 
Resource Report
Resource Website 		RRID:Addgene_61329 Green fluorescent protein Kanamycin PMID:25386923 Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:17:41 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch