Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
On page 346 showing 6901 ~ 6920 out of 12,972 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

    • RRID:Addgene_112702

http://www.addgene.org/112702

Species: Mus musculus
Genetic Insert: Nuclear Factor I X1
Vector Backbone Description: Vector Backbone:pCAGG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_112702 Copy   

    • RRID:Addgene_112701

http://www.addgene.org/112701

Species: Mus musculus
Genetic Insert: Nuclear Factor I C2
Vector Backbone Description: Vector Backbone:pCAGG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_112701 Copy   

    • RRID:Addgene_112732

http://www.addgene.org/112732

Species: Mus musculus
Genetic Insert: Fxr1p
Vector Backbone Description: Backbone Size:4547; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29706865

Proper citation: RRID:Addgene_112732 Copy   

    • RRID:Addgene_112713

    This resource has 1+ mentions.

http://www.addgene.org/112713

Species: Mus musculus
Genetic Insert: Rngtt
Vector Backbone Description: Backbone Marker:Addgene plasmid #35700; Backbone Size:6516; Vector Backbone:pcDNA3.1 mycBioID; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30166341
Comments: Tet operator sequence added to pcDNA3.1-myc-BirA*-cCE, originally described in Trotman et al. 2017 (10.1093/nar/gkx801) Additional internal sequencing primers: IntBirA1-F: CATTCGGAGCCAACCTGTACCTG IntBirA2-F: CGACAAGGAAATCTTCGGCATCTCC IntCE1-F: GAATGCCCCACCACTGAGAATACTG IntCE2-F: GTTAGGAGAGGTGCAGCAGAAATGTC IntCE3-F: CAAAGAAGTCAGCCATGAAATGGATGGAC

Proper citation: RRID:Addgene_112713 Copy   

http://www.addgene.org/112840

Species: Mus musculus
Genetic Insert: Grb2
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pcDNA3.1(+)/Puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26769899

Proper citation: RRID:Addgene_112840 Copy   

http://www.addgene.org/112844

Species: Mus musculus
Genetic Insert: Catulin-alpha-1
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pcDNA3.1(+)/Puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26769899

Proper citation: RRID:Addgene_112844 Copy   

    • RRID:Addgene_112846

http://www.addgene.org/112846

Species: Mus musculus
Genetic Insert: LL5BIP
Vector Backbone Description: Backbone Size:8280; Vector Backbone:pSyn; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: https://sciencematters.io/articles/201610000003

Proper citation: RRID:Addgene_112846 Copy   

http://www.addgene.org/112830

Species: Mus musculus
Genetic Insert: LL5BIP
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pcDNA3.1(+)/Puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: https://sciencematters.io/articles/201610000003

Proper citation: RRID:Addgene_112830 Copy   

http://www.addgene.org/112831

Species: Mus musculus
Genetic Insert: LL5BIP
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pcDNA3.1(+)/Puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: https://sciencematters.io/articles/201610000003

Proper citation: RRID:Addgene_112831 Copy   

http://www.addgene.org/112837

Species: Mus musculus
Genetic Insert: Grb2
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pcDNA3.1(+)/Puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26769899

Proper citation: RRID:Addgene_112837 Copy   

    • RRID:Addgene_112835

http://www.addgene.org/112835

Species: Mus musculus
Genetic Insert: Amotl2
Vector Backbone Description: Backbone Size:7500; Vector Backbone:pShuttle-CMV; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: An E371G difference is present in Amotl2 compared to the reference NM_019764.2 that is not of concern for function.

Proper citation: RRID:Addgene_112835 Copy   

    • RRID:Addgene_112818

    This resource has 1+ mentions.

http://www.addgene.org/112818

Species: Mus musculus
Genetic Insert: Eif4e
Vector Backbone Description: Backbone Marker:GE Healthcare; Backbone Size:4948; Vector Backbone:pGEX-2T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28981715

Proper citation: RRID:Addgene_112818 Copy   

http://www.addgene.org/113028

Species: Mus musculus
Genetic Insert: SNAP-Syk tSH2
Vector Backbone Description: Vector Backbone:pGEX6-2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29862966

Proper citation: RRID:Addgene_113028 Copy   

    • RRID:Addgene_113016

http://www.addgene.org/113016

Species: Mus musculus
Genetic Insert: CD22 CAR-P Megf10 intracellular domain
Vector Backbone Description: Vector Backbone:pHR; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29862966

Proper citation: RRID:Addgene_113016 Copy   

    • RRID:Addgene_113116

http://www.addgene.org/113116

Species: Mus musculus
Genetic Insert: Id2 donor region including homology arms and HaloTag
Vector Backbone Description: Vector Backbone:pbluescript; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29889212

Proper citation: RRID:Addgene_113116 Copy   

    • RRID:Addgene_113104

http://www.addgene.org/113104

Species: Mus musculus
Genetic Insert: N terminal Erk2 donor region including homology arms and HaloTag
Vector Backbone Description: Vector Backbone:pbluescript; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29889212

Proper citation: RRID:Addgene_113104 Copy   

    • RRID:Addgene_113103

    This resource has 1+ mentions.

http://www.addgene.org/113103

Species: Mus musculus
Genetic Insert: c terminal Ctcf donor region including homology arms and mAID-HaloTag
Vector Backbone Description: Vector Backbone:pbluescript; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29889212

Proper citation: RRID:Addgene_113103 Copy   

    • RRID:Addgene_113419

    This resource has 1+ mentions.

http://www.addgene.org/113419

Species: Mus musculus
Genetic Insert: mA3-BE3
Vector Backbone Description: Backbone Size:3399; Vector Backbone:CMV; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30125268

Proper citation: RRID:Addgene_113419 Copy   

    • RRID:Addgene_11349

    This resource has 10+ mentions.

http://www.addgene.org/11349

Species: Mus musculus
Genetic Insert: pgk-1 5' and 3' regions
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:3200; Vector Backbone:pGEM11; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8608936
Comments: Constructed by Peter Laird. See author's map. Includes 500 bp mouse PGK promoter, 700 bp puro, 460 bp PGK 3' end.

Proper citation: RRID:Addgene_11349 Copy   

    • RRID:Addgene_113500

    This resource has 1+ mentions.

http://www.addgene.org/113500

Species: Mus musculus
Genetic Insert: p37
Vector Backbone Description: Vector Backbone:pGEX-6P-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30344098

Proper citation: RRID:Addgene_113500 Copy   

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch