Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 35 showing 681 ~ 700 out of 33,834 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_55186

http://www.addgene.org/55186

Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:7266; Vector Backbone:pET, pCoofy3; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23410102
Comments: C-terminal tags are separated by a stop codon. Depending on the LP2 primer used in SLIC, the desired C-terminal tag(s) can be fused to the target gene. Use the one of the following linearization primers pairs for SLIC cloning. Choose one LP1 forward vector primer and one LP2 reverse vector primer: LP1 forward vector primer: SLIC Primer (3C site) 5' GGGCCCCTGGAACAGAACTTCCAG 3' LP2 - select an LP2 primer below depending on which C-terminal tags you want to include fused to your gene of interest: none SLIC Primer 5' CGCCATTAACCTGATGTTCTGGGG 3' 10His- SLIC Primer 5`GAGCATCATCATCATCACCAC 3' StrepOne - SLIC Primer 5`AGCGCTTGGAGCCACCCGCAG 3' S-Tag - SLIC Primer 5`AAAGAAACCGCTGCTGCTAAATTCG 3' CBP - SLIC Primer 5`ATGAAGCGGCGGTGGAAGAAAAAC 3' HPC4 - SLIC Primer 5`GAGGACCAGGTGGACCCCCGG 3' Æ54CPD - SLIC Primer 5`GGCAGCGGCAAGATCCTGCAC 3' Test each preparation of the plasmid by transforming it into non-resistant cells (ex. DH5a) to ensure negative selection by ccdB kills all the transformed cells as expected.

Proper citation: RRID:Addgene_55186 Copy   


  • RRID:Addgene_55187

http://www.addgene.org/55187

Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:7701; Vector Backbone:pET, pCoofy4; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23410102
Comments: C-terminal tags are separated by a stop codon. Depending on the LP2 primer used in SLIC, the desired C-terminal tag(s) can be fused to the target gene. Use the one of the following linearization primers pairs for SLIC cloning. Choose one LP1 forward vector primer and one LP2 reverse vector primer: LP1 forward vector primer: SLIC Primer (3C site) 5' GGGCCCCTGGAACAGAACTTCCAG 3' LP2 - select an LP2 primer below depending on which C-terminal tags you want to include fused to your gene of interest: none SLIC Primer 5' CGCCATTAACCTGATGTTCTGGGG 3' 10His- SLIC Primer 5`GAGCATCATCATCATCACCAC 3' StrepOne - SLIC Primer 5`AGCGCTTGGAGCCACCCGCAG 3' S-Tag - SLIC Primer 5`AAAGAAACCGCTGCTGCTAAATTCG 3' CBP - SLIC Primer 5`ATGAAGCGGCGGTGGAAGAAAAAC 3' HPC4 - SLIC Primer 5`GAGGACCAGGTGGACCCCCGG 3' Æ54CPD - SLIC Primer 5`GGCAGCGGCAAGATCCTGCAC 3' Test each preparation of the plasmid by transforming it into non-resistant cells (ex. DH5a) to ensure negative selection by ccdB kills all the transformed cells as expected.

Proper citation: RRID:Addgene_55187 Copy   


  • RRID:Addgene_63615

    This resource has 1+ mentions.

http://www.addgene.org/63615

Vector Backbone Description: Backbone Marker:Mullins, E.D., Kang, S., 2001. Transformation: a tool for studying fungal pathogens of plants. Cell. Mol. Life Sci. 58, 2043–205; Backbone Size:7483; Vector Backbone:pDHt; Vector Types:fungal expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:15893252

Proper citation: RRID:Addgene_63615 Copy   


http://www.addgene.org/63622

Species: T7 bacteriophage
Genetic Insert: CTGA-R13-AKSRV RNAP
Vector Backbone Description: Vector Backbone:pQE; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25279711

Proper citation: RRID:Addgene_63622 Copy   


  • RRID:Addgene_63623

http://www.addgene.org/63623

Species: T7 bacteriophage
Genetic Insert: T3 RRVH RNAP
Vector Backbone Description: Vector Backbone:pQE; Vector Types:; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25279711

Proper citation: RRID:Addgene_63623 Copy   


  • RRID:Addgene_63668

http://www.addgene.org/63668

Species: T7 bacteriophage
Genetic Insert: CGG-R12-KIRV RNAP
Vector Backbone Description: Vector Backbone:pQE; Vector Types:; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25279711

Proper citation: RRID:Addgene_63668 Copy   


  • RRID:Addgene_63679

http://www.addgene.org/63679

Species: Homo sapiens
Genetic Insert: XBP1
Vector Backbone Description: Vector Backbone:pShuttle2-Flag; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19416856

Proper citation: RRID:Addgene_63679 Copy   


  • RRID:Addgene_63723

    This resource has 1+ mentions.

http://www.addgene.org/63723

Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5731; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_63723 Copy   


  • RRID:Addgene_63681

http://www.addgene.org/63681

Vector Backbone Description: Vector Backbone:pShuttle-CMV; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_63681 Copy   


  • RRID:Addgene_63734

http://www.addgene.org/63734

Vector Backbone Description: Backbone Size:9231; Vector Backbone:pSN40; Vector Types:C. albicans bait plasmid; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20719741
Comments: Note--the ccdB gene contained is inactive as it is missing the start codon so no ccd survival strain is necessary.

Proper citation: RRID:Addgene_63734 Copy   


  • RRID:Addgene_63626

http://www.addgene.org/63626

Species: T7 bacteriophage
Genetic Insert: K1F IKR RNAP
Vector Backbone Description: Vector Backbone:pQE; Vector Types:; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25279711

Proper citation: RRID:Addgene_63626 Copy   


http://www.addgene.org/63627

Species: T7 bacteriophage
Genetic Insert: CTGA-R13-AKSIRV RNAP
Vector Backbone Description: Vector Backbone:pQE; Vector Types:; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25279711

Proper citation: RRID:Addgene_63627 Copy   


  • RRID:Addgene_63743

http://www.addgene.org/63743

Species: Saccharomyces cerevisiae
Genetic Insert: Dbp9
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4762; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25877921

Proper citation: RRID:Addgene_63743 Copy   


  • RRID:Addgene_63744

http://www.addgene.org/63744

Species: Saccharomyces cerevisiae
Genetic Insert: Drs1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4762; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25877921

Proper citation: RRID:Addgene_63744 Copy   


  • RRID:Addgene_63769

http://www.addgene.org/63769

Species: Saccharomyces cerevisiae
Genetic Insert: Nsr1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4762; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25877921

Proper citation: RRID:Addgene_63769 Copy   


  • RRID:Addgene_63764

http://www.addgene.org/63764

Species: Saccharomyces cerevisiae
Genetic Insert: Nog2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4762; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25877921

Proper citation: RRID:Addgene_63764 Copy   


  • RRID:Addgene_63766

http://www.addgene.org/63766

Species: Saccharomyces cerevisiae
Genetic Insert: Nop2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4762; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25877921

Proper citation: RRID:Addgene_63766 Copy   


  • RRID:Addgene_63762

http://www.addgene.org/63762

Species: Saccharomyces cerevisiae
Genetic Insert: Mak16
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4762; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25877921

Proper citation: RRID:Addgene_63762 Copy   


  • RRID:Addgene_63779

http://www.addgene.org/63779

Species: Saccharomyces cerevisiae
Genetic Insert: Tma16
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4762; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25877921

Proper citation: RRID:Addgene_63779 Copy   


  • RRID:Addgene_63773

http://www.addgene.org/63773

Species: Saccharomyces cerevisiae
Genetic Insert: Rrp1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4762; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25877921

Proper citation: RRID:Addgene_63773 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X