Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:caenorhabditis elegans (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

1,881 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pOD2087-trnDEG
 
Resource Report
Resource Website 		RRID:Addgene_89369 vhhGFP4-ZIF-1 Caenorhabditis elegans Ampicillin PMID:28619826 Backbone Marker:Christian Frøkjær-Jensen (Erik Jorgensen lab); Backbone Size:7328; Vector Backbone:pCFJ151; Vector Types:Targeting vector for Mos1 transposon mediated single copy transgene insertion; Bacterial Resistance:Ampicillin 2026-08-15 01:21:56 0
pOD2048-csnDEG
 
Resource Report
Resource Website 		RRID:Addgene_89368 vhhGFP4-ZIF-1 Caenorhabditis elegans Ampicillin PMID:28619826 Backbone Marker:Christian Frøkjær-Jensen (Erik Jorgensen lab); Backbone Size:7328; Vector Backbone:pCFJ151; Vector Types:Targeting vector for Mos1 transposon mediated single copy transgene insertion; Bacterial Resistance:Ampicillin 2026-08-15 01:21:56 0
coel::RFP
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_8938 unc-122 promoter Caenorhabditis elegans Ampicillin PMID:10545240 Marker for expression of RFP in coelomocytes. 4kb unc-122 promoter+ 4aa of 1st exon (8911-12903 of cosmid F11C3, start is at 12892) in SphI-BamHI sites of MC10-RFP (dsRed in AgeI-NotI). Backbone Size:4300; Vector Backbone:MC10-RFP; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:21:56 11
coel::GFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_8937 unc-122 promoter Caenorhabditis elegans Ampicillin PMID:10545240 Marker for expression of GFP in coelomocytes. 4kb unc-122 promoter+ 4aa of 1st exon (8911-12903 of cosmid F11C3, start is at 12892) in Pst-BamHI sites of pPD95.77. Backbone Size:4500; Vector Backbone:pPD95.77; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:21:56 3
pHIT318
 
Resource Report
Resource Website 		RRID:Addgene_204508 rpl-21p::2xHA::C04F12.1 (C. elegans) Caenorhabditis elegans Ampicillin PMID:37078421 2xHA tag in this plasmid is YPYDVPDYAAAYPYDVPDY Backbone Marker:Addgene #19330; Vector Backbone:pCFJ151; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:27:33 0
pHIT346
 
Resource Report
Resource Website 		RRID:Addgene_204505 5S rDNA (C. elegans) Caenorhabditis elegans Ampicillin PMID:37078421 The sequence information provided by the depositor was based on partial sequencing. Please refer to the sequence information from Addgene Vector Backbone:pUC19; Vector Types:Other; Bacterial Resistance:Ampicillin 2026-08-15 01:27:31 0
pHIT353
 
Resource Report
Resource Website 		RRID:Addgene_204506 CeRep55 tandem repeats from Y73B3A (C. elegans) Caenorhabditis elegans Ampicillin PMID:37078421 The number of tandem repeats in the insert could be slightly smaller than the number in the digital sequence file, but it does not affect hybridization experiments Vector Backbone:pHIT283 (derived from L4417); Vector Types:Other; Bacterial Resistance:Ampicillin 2026-08-15 01:27:31 0
pNMSB97
 
Resource Report
Resource Website 		RRID:Addgene_199317 rab-3p::lox2272::mtagBFP2::tbb-2 3'UTR::lox2272::ChR2-HDRC::SL2::jRGECO1a::let-858 3'UTR Caenorhabditis elegans Ampicillin PMID:37024651 Backbone Size:9131; Vector Backbone:pCFJ150; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin mTagBFP2 from pJJR81, ChR2(H134R;D156C), C. elegans codon optimized jRGECO1a with 1 intron 2026-08-15 01:27:32 0
pNMSB96
 
Resource Report
Resource Website 		RRID:Addgene_199316 flp-18p::lox2272::mTagBFP2::tbb-2 3'UTR::lox2272::ACR1::SL2::jRGECO1a::let-858 3'UTR Caenorhabditis elegans Ampicillin PMID:37024651 Backbone Size:9131; Vector Backbone:pCFJ150; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin mTagBFP2 from pJJR81, C. elegans codon optimized jRGECO1a with 1 intron 2026-08-15 01:27:32 0
pNMSB104
 
Resource Report
Resource Website 		RRID:Addgene_199314 flp-18p::lox2272::mTagBFP2::tbb-2 3'UTR::lox2272::ChRmine::SL2::jRGECO1a::let-858 3'UTR Caenorhabditis elegans Ampicillin PMID:37024651 Backbone Size:9131; Vector Backbone:pCFJ150; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin mTagBFP2 from pJJR81, C. elegans codon optimized ChRmine with 1 intron, C. elegans codon optimized jRGECO1a with 1 intron 2026-08-15 01:27:35 0
pNMSB131
 
Resource Report
Resource Website 		RRID:Addgene_199311 eft-3p::lox2272::mTagBFP2::tbb-2 3'UTR::lox2272::ChR2-HDRC::SL2::jRGECO1a::let-858 3'UTR Caenorhabditis elegans Ampicillin PMID:37024651 Backbone Size:9131; Vector Backbone:pCFJ150; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin mTagBFP2 from pJJR81, ChR2(H134R;D156C), C. elegans codon optimized jRGECO1a with 1 intron 2026-08-15 01:27:32 0
pNMSB132
 
Resource Report
Resource Website 		RRID:Addgene_199310 rgef-1p::lox2272::mTagBFP2::tbb-2 3'UTR::lox2272::ChR2-HDRC::SL2::jRGECO1a::let-858 3'UTR Caenorhabditis elegans Ampicillin PMID:37024651 Backbone Size:9131; Vector Backbone:pCFJ150; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin mTagBFP2 from pJJR81, ChR2(H134R;D156C), C. elegans codon optimized jRGECO1a with 1 intron 2026-08-15 01:27:32 0
pNMSB109
 
Resource Report
Resource Website 		RRID:Addgene_199322 15xUAS::delta pes-10::::CaMBI::let-858 3'UTR Caenorhabditis elegans Ampicillin PMID:37024651 Vector Backbone:pHW394; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin Orange CaMBI with 300 nM KD for calcium 2026-08-15 01:27:32 0
pNMSB99
 
Resource Report
Resource Website 		RRID:Addgene_199308 myo-3p::lox2272::mTagBFP2::tbb-2 3'UTR::lox2272::ChR2-HDRC::SL2::jRGECO1a::let-858 3'UTR Caenorhabditis elegans Ampicillin PMID:37024651 Backbone Size:9131; Vector Backbone:pCFJ150; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin mTagBFP2 from pJJR81, ChR2(H134R;D156C), C. elegans codon optimized jRGECO1a with 1 intron 2026-08-15 01:27:32 0
pNMSB84
 
Resource Report
Resource Website 		RRID:Addgene_199309 flp-18p::lox2272::mTagBFP2::tbb-2 3'UTR::lox2272::ChR2-HDRC::SL2::jRGECO1a::let-858 3'UTR Caenorhabditis elegans Ampicillin PMID:37024651 Backbone Size:9131; Vector Backbone:pCFJ150; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin mTagBFP2 from pJJR81, ChR2(H134R;D156C), C. elegans codon optimized jRGECO1a with 1 intron 2026-08-15 01:27:35 0
pSH83
 
Resource Report
Resource Website 		RRID:Addgene_212989 flp-13 promoter Caenorhabditis elegans Ampicillin PMID:31584430 Cloning Method: In-Fusion cloning Backbone Size:5429; Vector Backbone:pSH11; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:28:52 0
pMS114
 
Resource Report
Resource Website 		RRID:Addgene_215677 5'HA + MCS + loxN + rps-0p::5'ΔHygR Caenorhabditis elegans Ampicillin PMID:38351905 Vector Backbone:pMS94; Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin 5' ∆HYGR encodes aa1-226 2026-08-15 01:29:16 0
pMS62
 
Resource Report
Resource Website 		RRID:Addgene_215676 eef-1A.1p::Cas9 + U6p::GTCGTTCTTCCGTTCTCGGG Caenorhabditis elegans Ampicillin PMID:38351905 Vector Backbone:pDD162; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:29:17 0
pMS18
 
Resource Report
Resource Website 		RRID:Addgene_215675 eef-1A.1p::Cas9 + U6p::GAAATCGCCGACTTGCGAGG Caenorhabditis elegans Ampicillin PMID:38351905 Vector Backbone:pDD162; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:29:17 0
pDV06 [punc-17::SNG-1::CRY2(535)]
 
Resource Report
Resource Website 		RRID:Addgene_197597 Synaptogyrin-CRY2 (E490G + residues 1-535) Caenorhabditis elegans Ampicillin PMID:36535932 Backbone Marker:J. Rand; Vector Backbone:RM#348p; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin E490G 2026-08-15 01:28:26 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch