Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 35 showing 681 ~ 700 out of 1,881 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_89369

http://www.addgene.org/89369

Species: Caenorhabditis elegans
Genetic Insert: vhhGFP4-ZIF-1
Vector Backbone Description: Backbone Marker:Christian Frøkjær-Jensen (Erik Jorgensen lab); Backbone Size:7328; Vector Backbone:pCFJ151; Vector Types:Targeting vector for Mos1 transposon mediated single copy transgene insertion; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28619826

Proper citation: RRID:Addgene_89369 Copy   


  • RRID:Addgene_89368

http://www.addgene.org/89368

Species: Caenorhabditis elegans
Genetic Insert: vhhGFP4-ZIF-1
Vector Backbone Description: Backbone Marker:Christian Frøkjær-Jensen (Erik Jorgensen lab); Backbone Size:7328; Vector Backbone:pCFJ151; Vector Types:Targeting vector for Mos1 transposon mediated single copy transgene insertion; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28619826

Proper citation: RRID:Addgene_89368 Copy   


  • RRID:Addgene_8938

    This resource has 10+ mentions.

http://www.addgene.org/8938

Species: Caenorhabditis elegans
Genetic Insert: unc-122 promoter
Vector Backbone Description: Backbone Size:4300; Vector Backbone:MC10-RFP; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10545240
Comments: Marker for expression of RFP in coelomocytes. 4kb unc-122 promoter+ 4aa of 1st exon (8911-12903 of cosmid F11C3, start is at 12892) in SphI-BamHI sites of MC10-RFP (dsRed in AgeI-NotI).

Proper citation: RRID:Addgene_8938 Copy   


  • RRID:Addgene_8937

    This resource has 1+ mentions.

http://www.addgene.org/8937

Species: Caenorhabditis elegans
Genetic Insert: unc-122 promoter
Vector Backbone Description: Backbone Size:4500; Vector Backbone:pPD95.77; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10545240
Comments: Marker for expression of GFP in coelomocytes. 4kb unc-122 promoter+ 4aa of 1st exon (8911-12903 of cosmid F11C3, start is at 12892) in Pst-BamHI sites of pPD95.77.

Proper citation: RRID:Addgene_8937 Copy   


  • RRID:Addgene_204508

http://www.addgene.org/204508

Species: Caenorhabditis elegans
Genetic Insert: rpl-21p::2xHA::C04F12.1 (C. elegans)
Vector Backbone Description: Backbone Marker:Addgene #19330; Vector Backbone:pCFJ151; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37078421
Comments: 2xHA tag in this plasmid is YPYDVPDYAAAYPYDVPDY

Proper citation: RRID:Addgene_204508 Copy   


  • RRID:Addgene_204505

http://www.addgene.org/204505

Species: Caenorhabditis elegans
Genetic Insert: 5S rDNA (C. elegans)
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Other; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37078421
Comments: The sequence information provided by the depositor was based on partial sequencing. Please refer to the sequence information from Addgene

Proper citation: RRID:Addgene_204505 Copy   


  • RRID:Addgene_204506

http://www.addgene.org/204506

Species: Caenorhabditis elegans
Genetic Insert: CeRep55 tandem repeats from Y73B3A (C. elegans)
Vector Backbone Description: Vector Backbone:pHIT283 (derived from L4417); Vector Types:Other; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37078421
Comments: The number of tandem repeats in the insert could be slightly smaller than the number in the digital sequence file, but it does not affect hybridization experiments

Proper citation: RRID:Addgene_204506 Copy   


  • RRID:Addgene_199317

http://www.addgene.org/199317

Species: Caenorhabditis elegans
Genetic Insert: rab-3p::lox2272::mtagBFP2::tbb-2 3'UTR::lox2272::ChR2-HDRC::SL2::jRGECO1a::let-858 3'UTR
Vector Backbone Description: Backbone Size:9131; Vector Backbone:pCFJ150; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37024651

Proper citation: RRID:Addgene_199317 Copy   


  • RRID:Addgene_199316

http://www.addgene.org/199316

Species: Caenorhabditis elegans
Genetic Insert: flp-18p::lox2272::mTagBFP2::tbb-2 3'UTR::lox2272::ACR1::SL2::jRGECO1a::let-858 3'UTR
Vector Backbone Description: Backbone Size:9131; Vector Backbone:pCFJ150; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37024651

Proper citation: RRID:Addgene_199316 Copy   


  • RRID:Addgene_199314

http://www.addgene.org/199314

Species: Caenorhabditis elegans
Genetic Insert: flp-18p::lox2272::mTagBFP2::tbb-2 3'UTR::lox2272::ChRmine::SL2::jRGECO1a::let-858 3'UTR
Vector Backbone Description: Backbone Size:9131; Vector Backbone:pCFJ150; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37024651

Proper citation: RRID:Addgene_199314 Copy   


  • RRID:Addgene_199311

http://www.addgene.org/199311

Species: Caenorhabditis elegans
Genetic Insert: eft-3p::lox2272::mTagBFP2::tbb-2 3'UTR::lox2272::ChR2-HDRC::SL2::jRGECO1a::let-858 3'UTR
Vector Backbone Description: Backbone Size:9131; Vector Backbone:pCFJ150; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37024651

Proper citation: RRID:Addgene_199311 Copy   


  • RRID:Addgene_199310

http://www.addgene.org/199310

Species: Caenorhabditis elegans
Genetic Insert: rgef-1p::lox2272::mTagBFP2::tbb-2 3'UTR::lox2272::ChR2-HDRC::SL2::jRGECO1a::let-858 3'UTR
Vector Backbone Description: Backbone Size:9131; Vector Backbone:pCFJ150; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37024651

Proper citation: RRID:Addgene_199310 Copy   


  • RRID:Addgene_199322

http://www.addgene.org/199322

Species: Caenorhabditis elegans
Genetic Insert: 15xUAS::delta pes-10::::CaMBI::let-858 3'UTR
Vector Backbone Description: Vector Backbone:pHW394; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37024651

Proper citation: RRID:Addgene_199322 Copy   


  • RRID:Addgene_199308

http://www.addgene.org/199308

Species: Caenorhabditis elegans
Genetic Insert: myo-3p::lox2272::mTagBFP2::tbb-2 3'UTR::lox2272::ChR2-HDRC::SL2::jRGECO1a::let-858 3'UTR
Vector Backbone Description: Backbone Size:9131; Vector Backbone:pCFJ150; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37024651

Proper citation: RRID:Addgene_199308 Copy   


  • RRID:Addgene_199309

http://www.addgene.org/199309

Species: Caenorhabditis elegans
Genetic Insert: flp-18p::lox2272::mTagBFP2::tbb-2 3'UTR::lox2272::ChR2-HDRC::SL2::jRGECO1a::let-858 3'UTR
Vector Backbone Description: Backbone Size:9131; Vector Backbone:pCFJ150; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37024651

Proper citation: RRID:Addgene_199309 Copy   


  • RRID:Addgene_212989

http://www.addgene.org/212989

Species: Caenorhabditis elegans
Genetic Insert: flp-13 promoter
Vector Backbone Description: Backbone Size:5429; Vector Backbone:pSH11; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31584430
Comments: Cloning Method: In-Fusion cloning

Proper citation: RRID:Addgene_212989 Copy   


  • RRID:Addgene_215677

http://www.addgene.org/215677

Species: Caenorhabditis elegans
Genetic Insert: 5'HA + MCS + loxN + rps-0p::5'ΔHygR
Vector Backbone Description: Vector Backbone:pMS94; Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38351905

Proper citation: RRID:Addgene_215677 Copy   


  • RRID:Addgene_215676

http://www.addgene.org/215676

Species: Caenorhabditis elegans
Genetic Insert: eef-1A.1p::Cas9 + U6p::GTCGTTCTTCCGTTCTCGGG
Vector Backbone Description: Vector Backbone:pDD162; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38351905

Proper citation: RRID:Addgene_215676 Copy   


  • RRID:Addgene_215675

http://www.addgene.org/215675

Species: Caenorhabditis elegans
Genetic Insert: eef-1A.1p::Cas9 + U6p::GAAATCGCCGACTTGCGAGG
Vector Backbone Description: Vector Backbone:pDD162; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38351905

Proper citation: RRID:Addgene_215675 Copy   


http://www.addgene.org/197597

Species: Caenorhabditis elegans
Genetic Insert: Synaptogyrin-CRY2 (E490G + residues 1-535)
Vector Backbone Description: Backbone Marker:J. Rand; Vector Backbone:RM#348p; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36535932

Proper citation: RRID:Addgene_197597 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X