Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
CMV mRuby3-Synapsin1a Resource Report Resource Website 1+ mentions |
RRID:Addgene_187896 | Synapsin1a | Rattus norvegicus | Kanamycin | F255Y and S304A mutations in Synapsin1a insert do not affect plasmid function. | Backbone Marker:Clontech, Palo Alto, California; Backbone Size:3998; Vector Backbone:pEGFP-C1 vector; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:23:22 | 3 | ||
|
pN1-RnKIF5C(1-560)-Halo-Flag Resource Report Resource Website |
RRID:Addgene_188071 | rat KIF5C | Rattus norvegicus | Kanamycin | PMID:35504282 | Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | aa1-560 | 2026-08-15 01:23:26 | 0 | |
|
pN1-RnKIF5C(1-560,Δ6)-Halo-Flag Resource Report Resource Website |
RRID:Addgene_188072 | rat KIF5C | Rattus norvegicus | Kanamycin | PMID:35504282 | Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | aa1-560, deletion of aa2-6 | 2026-08-15 01:23:26 | 0 | |
|
EGFP-Myo1b Resource Report Resource Website |
RRID:Addgene_187362 | myosin 1b isoform b | Rattus norvegicus | Kanamycin | PMID:10233157 | The expression of the recombinant plasmid includes the addition of 18 amino acids (SGLRSRAQASNSDPRYPP) between GFP and Myo1b. | Backbone Marker:Clontech; Backbone Size:4752; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:23:29 | 0 | |
|
Cherry-Myo1b Resource Report Resource Website |
RRID:Addgene_187366 | myosin 1b isoform b | Rattus norvegicus | Kanamycin | PMID:29588377 | The expression of the recombinant plasmid includes the addition of 18 amino acids (SGLRSRAQASNSDPRYPP) between Cherry and Myo1b. | Backbone Marker:Clontech; Backbone Size:4743; Vector Backbone:pmCherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:23:29 | 0 | |
|
EGFP-Myo1b-Tail Resource Report Resource Website |
RRID:Addgene_187365 | myosin 1b isoform b Tail domain | Rattus norvegicus | Kanamycin | PMID:26195670 | PCR cloning at BglII-SalI DNA fragment was generated by PCR on rat Myo1b cDNA with 5' primer TTGGCCATCAAGACCTTACCTA and 3' primer CCTCACTTAAGGGACAGCGACTT | Backbone Marker:Clontech; Backbone Size:4713; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:23:29 | 0 | |
|
EGFP-Myo1-IQ-Tail Resource Report Resource Website |
RRID:Addgene_187363 | myosin 1b isoform b IQTail domain | Rattus norvegicus | Kanamycin | PMID:10233157 | The expression of the recombinant plasmid includes the addition of 18 amino acids (SGLRSRAQASNSDPRYPP) between GFP and Myo1b. Cloning by deletion of the fragment EcoRV-EcoRV from the recombinant plasmid encoding GFP-Myo1b. | Backbone Marker:Clontech; Backbone Size:4743; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:23:30 | 0 | |
|
Stx3 Resource Report Resource Website |
RRID:Addgene_186685 | Syntaxin 3 | Rattus norvegicus | Ampicillin | PMID:35322233 | Vector Backbone:pTEV5; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:23:30 | 0 | ||
|
pMSCV mKeima-LC3 Resource Report Resource Website 1+ mentions |
RRID:Addgene_189006 | mKeima, LC3 | Rattus norvegicus | Ampicillin | PMID:37443159 | Please visit https://www.biorxiv.org/content/10.1101/2022.02.22.481456v1 for bioRxiv preprint. | Vector Backbone:pMSCV PGK-neo; Vector Types:Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:23:44 | 1 | |
|
Stx3-mCitrine-mCherry Resource Report Resource Website |
RRID:Addgene_92426 | Stx3 | Rattus norvegicus | Kanamycin | PMID:28524818 | Backbone Marker:CloneTech; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:22:30 | 0 | ||
|
pET28b-BE3∆UGI Resource Report Resource Website |
RRID:Addgene_96943 | BE3∆UGI | Rattus norvegicus | Kanamycin | PMID:28398345 | Backbone Marker:Novagen ; Backbone Size:5334; Vector Backbone:pET28b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:22:31 | 0 | ||
|
pAAVTREGCaMP6f Resource Report Resource Website 1+ mentions |
RRID:Addgene_97410 | GCaMP6f | Rattus norvegicus | Ampicillin | PMID:26655910 | Backbone Marker:Stratagene; Backbone Size:4477; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | 2026-08-15 01:22:35 | 2 | ||
|
GLT-1b delta 4 Resource Report Resource Website |
RRID:Addgene_98707 | Glt1b | Rattus norvegicus | Ampicillin | Please note that mutations I521V and N538Y in Glt1b (reference AF451299) were found during Addgene's quality control. The depositor noted that these mutations do NOT affect plasmid function. | Backbone Marker:Invitrogen; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | missing last 4 amino acids at the C-terminus. I521V and N538Y (please see depositor comments section below) | 2026-08-15 01:22:42 | 0 | |
|
pLV-shIl22ra2-1408 Resource Report Resource Website |
RRID:Addgene_99032 | Il22ra2 | Rattus norvegicus | Ampicillin | PMID:25585681 | This plasmid was generated as part of the NIAAA-funded INIA consortium. | Backbone Size:7649; Vector Backbone:pLL3.7; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:22:44 | 0 | |
|
pEGFP ratAPOBEC1 L173A/G227A Resource Report Resource Website |
RRID:Addgene_167169 | APOBEC1 | Rattus norvegicus | Kanamycin | Backbone Marker:Clontech; Backbone Size:3943; Vector Backbone:pEGFP-C3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | changed Leucine 173 to Alanine; changed Glycine 227 to Alanine | 2026-08-15 01:22:56 | 0 | ||
|
pSL007_PB_pCMV-H2B-mIFP-T2A-rTetR-ratKRAB-zeo Resource Report Resource Website 1+ mentions |
RRID:Addgene_179438 | H2B-mIFP-T2A-rTetR-KRAB | Rattus norvegicus | Ampicillin | PMID:35678392 | Please visit https://www.biorxiv.org/content/10.1101/2021.11.04.467237v1 for bioRxiv preprint. | Vector Backbone:pPB (PiggyBac); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:23:00 | 1 | |
|
iLID-mCherry-iTrkA Resource Report Resource Website |
RRID:Addgene_136509 | iLID mCherry iTrkA | Rattus norvegicus | Kanamycin | PMID:32335036 | Backbone Size:3900; Vector Backbone:pEGFP N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:23:02 | 0 | ||
|
iLID-mRuby3-iTrkA Resource Report Resource Website |
RRID:Addgene_136510 | iLID mRuby3 iTrkA | Rattus norvegicus | Kanamycin | PMID:32335036 | Backbone Size:3900; Vector Backbone:pEGFP N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:23:02 | 0 | ||
|
pcDNA3-EGFP-AC8(1-106) Resource Report Resource Website |
RRID:Addgene_181958 | EGFP-AC8(1-106) | Rattus norvegicus | Ampicillin | PMID:33201801 | Backbone Marker:Invitrogen; Backbone Size:5430; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:23:04 | 0 | ||
|
pGEX-4T Doc2beta C2AB(125) F222C Resource Report Resource Website |
RRID:Addgene_134692 | Double C2 protein beta | Rattus norvegicus | Ampicillin | PMID:31147445 | Backbone Marker:GE Healthcare; Vector Backbone:pGEX4T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | F222C, C145A, C217A, C249A, C290A, C338A, C387A | 2026-08-15 01:23:09 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
