Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Bacterial Resistance:kanamycin (facet)


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

33,912 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
mEos3.2-Telethonin-N-18
 
Resource Report
Resource Website
RRID:Addgene_62771 Telethonin Mus musculus Kanamycin Vector Backbone:N1 Cloning Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin none 2026-08-15 01:17:55 0
p3E-GFPmem no-pA
 
Resource Report
Resource Website
RRID:Addgene_80817 GFPcaax no pA p3E Kanamycin PMID:27500400 Backbone Marker:Invitrogen; Backbone Size:2619; Vector Backbone:pDONR P2R-P3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:20:42 0
p3E-GFP no-pA
 
Resource Report
Resource Website
RRID:Addgene_80813 GFP no pA Other Kanamycin PMID:27500400 Backbone Marker:Invitrogen; Backbone Size:2619; Vector Backbone:pDONR P2R-P3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:20:42 0
pTSK29
 
Resource Report
Resource Website
RRID:Addgene_80779 Kanamycin PMID:9887310 Backbone Marker:Wang, R.F. and S. R. Kushner. 1991. Gene 100:195-199.; Vector Backbone:pWSK29; Vector Types:; Bacterial Resistance:Kanamycin 2026-08-15 01:20:41 0
pProm1_BCD21-GFP
 
Resource Report
Resource Website
RRID:Addgene_80652 GFP Kanamycin PMID:25126893 Backbone Marker:N/A; Vector Backbone:N/A; Vector Types:p15A origin, constitutive promoter, KanR; Bacterial Resistance:Kanamycin NONE 2026-08-15 01:20:40 0
pME-mKate2 no stop
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_80806 pME-mKate2 no stop Other Kanamycin PMID:27500400 Backbone Marker:Invitrogen; Backbone Size:2518; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:20:41 1
p5E-ESyn1
 
Resource Report
Resource Website
RRID:Addgene_80804 p5E-ESyn1 Kanamycin PMID:27500400 Backbone Marker:Invitrogen; Backbone Size:2623; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:20:41 0
pDonor-tBFP-NLS-Neo (Universal)
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_80767 PITCh-gRNA#3 targeting sequence (GCATCGTACGCGTACGTGTT) Synthetic Kanamycin PMID:28179459 Backbone Marker:Kazuhisa Nakayama Lab. (Addgene plasmid #80766); Backbone Size:4761; Vector Backbone:pDonor-tBFP-NLS-Neo; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin 2026-08-15 01:20:41 19
pENTR-SYNZIP16
 
Resource Report
Resource Website
RRID:Addgene_80670 SYNZIP16 Synthetic Kanamycin PMID:22558529 Backbone Marker:Invitrogen; Backbone Size:2592; Vector Backbone:pENTR_D-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 2026-08-15 01:20:41 0
pENTR-SYNZIP22
 
Resource Report
Resource Website
RRID:Addgene_80676 SYNZIP22 Synthetic Kanamycin PMID:22558529 Backbone Marker:Invitrogen; Backbone Size:2592; Vector Backbone:pENTR_D-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 2026-08-15 01:20:41 0
pET-IG-mSA
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_80706 Monomeric streptavidin Synthetic Kanamycin PMID:26979420 Backbone Marker:Homemade; Backbone Size:5300; Vector Backbone:pET-IG; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:20:41 2
pENTR-SYNZIP7
 
Resource Report
Resource Website
RRID:Addgene_80663 SYNZIP7 Synthetic Kanamycin PMID:22558529 Backbone Marker:Invitrogen; Backbone Size:2586; Vector Backbone:pENTR_D-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 2026-08-15 01:20:40 0
pCDB181
 
Resource Report
Resource Website
RRID:Addgene_80692 gEHEE_06 Synthetic Kanamycin PMID:27626386 Backbone Marker:custom made; Backbone Size:6155; Vector Backbone:pCDB180; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:20:41 0
pCDB289
 
Resource Report
Resource Website
RRID:Addgene_80690 gEEHE_02 Synthetic Kanamycin PMID:27626386 Backbone Marker:custom made; Backbone Size:6155; Vector Backbone:pCDB180; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:20:41 0
pCDB267
 
Resource Report
Resource Website
RRID:Addgene_80695 gHHH_06 Synthetic Kanamycin PMID:27626386 Backbone Marker:custom made; Backbone Size:6155; Vector Backbone:pCDB180; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:20:41 0
pCDB294
 
Resource Report
Resource Website
RRID:Addgene_80693 gHEEE_02 Synthetic Kanamycin PMID:27626386 Backbone Marker:custom made; Backbone Size:6155; Vector Backbone:pCDB180; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:20:41 0
pCDB185
 
Resource Report
Resource Website
RRID:Addgene_80688 gEEH_04 Synthetic Kanamycin PMID:27626386 Backbone Marker:custom made; Backbone Size:6155; Vector Backbone:pCDB180; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:20:41 0
pCDB285
 
Resource Report
Resource Website
RRID:Addgene_80687 gEEEH_04 Synthetic Kanamycin PMID:27626386 Backbone Marker:custom made; Backbone Size:6155; Vector Backbone:pCDB180; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:20:41 0
p3E-P2A-mKate2 no-pA
 
Resource Report
Resource Website
RRID:Addgene_80828 p3E-P2A-mKate2 no pA Other Kanamycin PMID:27500400 Backbone Marker:Invitrogen; Vector Backbone:pDONR P2R-P3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:20:42 0
p3E-P2A-CFP no-pA
 
Resource Report
Resource Website
RRID:Addgene_80827 p3E-P2A-CFP no pA Other Kanamycin PMID:27500400 Backbone Marker:Invitrogen; Vector Backbone:pDONR P2R-P3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:20:42 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.