Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: Telethonin
Vector Backbone Description: Vector Backbone:N1 Cloning Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_62771 Copy
Genetic Insert: GFPcaax no pA p3E
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2619; Vector Backbone:pDONR P2R-P3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:27500400
Proper citation: RRID:Addgene_80817 Copy
Species: Other
Genetic Insert: GFP no pA
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2619; Vector Backbone:pDONR P2R-P3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:27500400
Proper citation: RRID:Addgene_80813 Copy
Vector Backbone Description: Backbone Marker:Wang, R.F. and S. R. Kushner. 1991. Gene 100:195-199.; Vector Backbone:pWSK29; Vector Types:; Bacterial Resistance:Kanamycin
Defining Citation: PMID:9887310
Proper citation: RRID:Addgene_80779 Copy
Genetic Insert: GFP
Vector Backbone Description: Backbone Marker:N/A; Vector Backbone:N/A; Vector Types:p15A origin, constitutive promoter, KanR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25126893
Proper citation: RRID:Addgene_80652 Copy
Species: Other
Genetic Insert: pME-mKate2 no stop
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2518; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:27500400
Proper citation: RRID:Addgene_80806 Copy
Genetic Insert: p5E-ESyn1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2623; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:27500400
Proper citation: RRID:Addgene_80804 Copy
Species: Synthetic
Genetic Insert: PITCh-gRNA#3 targeting sequence (GCATCGTACGCGTACGTGTT)
Vector Backbone Description: Backbone Marker:Kazuhisa Nakayama Lab. (Addgene plasmid #80766); Backbone Size:4761; Vector Backbone:pDonor-tBFP-NLS-Neo; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:28179459
Proper citation: RRID:Addgene_80767 Copy
Species: Synthetic
Genetic Insert: SYNZIP16
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2592; Vector Backbone:pENTR_D-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22558529
Proper citation: RRID:Addgene_80670 Copy
Species: Synthetic
Genetic Insert: SYNZIP22
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2592; Vector Backbone:pENTR_D-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22558529
Proper citation: RRID:Addgene_80676 Copy
Species: Synthetic
Genetic Insert: Monomeric streptavidin
Vector Backbone Description: Backbone Marker:Homemade; Backbone Size:5300; Vector Backbone:pET-IG; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26979420
Proper citation: RRID:Addgene_80706 Copy
Species: Synthetic
Genetic Insert: SYNZIP7
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2586; Vector Backbone:pENTR_D-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22558529
Proper citation: RRID:Addgene_80663 Copy
Species: Synthetic
Genetic Insert: gEHEE_06
Vector Backbone Description: Backbone Marker:custom made; Backbone Size:6155; Vector Backbone:pCDB180; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:27626386
Proper citation: RRID:Addgene_80692 Copy
Species: Synthetic
Genetic Insert: gEEHE_02
Vector Backbone Description: Backbone Marker:custom made; Backbone Size:6155; Vector Backbone:pCDB180; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:27626386
Proper citation: RRID:Addgene_80690 Copy
Species: Synthetic
Genetic Insert: gHHH_06
Vector Backbone Description: Backbone Marker:custom made; Backbone Size:6155; Vector Backbone:pCDB180; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:27626386
Proper citation: RRID:Addgene_80695 Copy
Species: Synthetic
Genetic Insert: gHEEE_02
Vector Backbone Description: Backbone Marker:custom made; Backbone Size:6155; Vector Backbone:pCDB180; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:27626386
Proper citation: RRID:Addgene_80693 Copy
Species: Synthetic
Genetic Insert: gEEH_04
Vector Backbone Description: Backbone Marker:custom made; Backbone Size:6155; Vector Backbone:pCDB180; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:27626386
Proper citation: RRID:Addgene_80688 Copy
Species: Synthetic
Genetic Insert: gEEEH_04
Vector Backbone Description: Backbone Marker:custom made; Backbone Size:6155; Vector Backbone:pCDB180; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:27626386
Proper citation: RRID:Addgene_80687 Copy
Species: Other
Genetic Insert: p3E-P2A-mKate2 no pA
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pDONR P2R-P3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:27500400
Proper citation: RRID:Addgene_80828 Copy
Species: Other
Genetic Insert: p3E-P2A-CFP no pA
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pDONR P2R-P3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:27500400
Proper citation: RRID:Addgene_80827 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
