Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Bacterial Resistance:kanamycin (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

33,912 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pAKW.111A-SETD7
 
Resource Report
Resource Website 		RRID:Addgene_154052 Histone-lysine N-methyltransferase SETD7 Homo sapiens Kanamycin Backbone Size:1974; Vector Backbone:pAJM.029; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin changed tyrosine 305 to phenylalanine 2026-08-15 01:24:15 0
pMGU
 
Resource Report
Resource Website 		RRID:Addgene_139933 sfGFP Synthetic Kanamycin Vector Backbone:pMGU; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:24:14 0
pMGA-ptac-sfGFP
 
Resource Report
Resource Website 		RRID:Addgene_139934 LacI-Ptac-sfGFP Synthetic Kanamycin Vector Backbone:pMGA; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:24:14 0
pMGA
 
Resource Report
Resource Website 		RRID:Addgene_139931 sfGFP Synthetic Kanamycin PMID:31922737 Vector Backbone:pMGA; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:24:14 0
pMGA-ptet-sfGFP
 
Resource Report
Resource Website 		RRID:Addgene_139935 TetR-Ptet-sfGFP Synthetic Kanamycin Vector Backbone:pMGA; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:24:14 0
pMax_mPlum
 
Resource Report
Resource Website 		RRID:Addgene_177830 mPlum Synthetic Kanamycin PMID:24757057 For more information, see Piett, Pecen et al. 2021 Nat Protoc. (doi: 10.1038/s41596-021-00577-3). This plasmid has been found to be prone to multimerization. Multimerization often does not impact plasmid function, but it may reduce transformation efficiencies. If you need to isolate the monomeric version, you might consider linearizing, gel extracting, re-ligating, and transforming the plasmid. Vector Backbone:pMax; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:24:15 0
pSLS.436
 
Resource Report
Resource Website 		RRID:Addgene_184953 Eco1: ncRNA(wt) and RT E. coli Kanamycin PMID:34949838 Vector Backbone:pRSFDUET-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:24:15 0
pLY232
 
Resource Report
Resource Website 		RRID:Addgene_184149 s-tracrRNA-WT Synthetic Kanamycin PMID:35410423 Backbone Marker:by de Lorenzo's Lab (The Standard European Vector Architecture (SEVA) platform); Backbone Size:3821; Vector Backbone:pSEVA221; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-15 01:24:17 0
pENT-L1-Kozak-Ensconsin-3XGFP-stop-L2
 
Resource Report
Resource Website 		RRID:Addgene_186361 Human Ensconsin Homo sapiens Kanamycin PMID:17878951 Backbone Marker:PMID: 14736459; Backbone Size:2544; Vector Backbone:PDONR-221 P1-P2; Vector Types:Expression of a fluorescent microtubule marker; Bacterial Resistance:Kanamycin 2026-08-15 01:24:18 0
pFBP_2xNbLYS1::LUZ
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_189918 pLHB1B1:NnCPH:tSlH4, p35S_Short_TMV 5':AsNpga:tAtug7, pAtUbi1:NnH3H:tAtuNos, pCmYLCV:NnHisps:tHsp, p2xNbLYS1:NnLuz:tAtuOcs Neonothopanus nambi, Nicotiana benthamiana, Aspergillus nidulans Kanamycin PMID:36583694 Please visit https://www.biorxiv.org/content/10.1101/2022.07.28.501876v1 for bioRxiv preprint. Vector Backbone:pTRANS_220d; Vector Types:Plant Expression, Luciferase; Bacterial Resistance:Kanamycin 2026-08-15 01:24:17 1
pWS5321-CRISPRai-Markerless
 
Resource Report
Resource Website 		RRID:Addgene_182828 Kanamycin PMID:36008396 Vector Backbone:ColE1; Vector Types:CRISPR; Bacterial Resistance:Kanamycin 2026-08-15 01:24:18 0
pWS5396-CRISPRai-KanR
 
Resource Report
Resource Website 		RRID:Addgene_182835 Kanamycin PMID:36008396 Vector Backbone:ColE1; Vector Types:CRISPR; Bacterial Resistance:Kanamycin 2026-08-15 01:24:18 0
pWS5395-CRISPRai-LYS2
 
Resource Report
Resource Website 		RRID:Addgene_182834 Kanamycin PMID:36008396 Vector Backbone:ColE1; Vector Types:CRISPR; Bacterial Resistance:Kanamycin 2026-08-15 01:24:18 0
pWS5399-CRISPRai-ZeoR
 
Resource Report
Resource Website 		RRID:Addgene_182838 Kanamycin PMID:36008396 Vector Backbone:ColE1; Vector Types:CRISPR; Bacterial Resistance:Kanamycin 2026-08-15 01:24:18 0
pDONR221-si:ch73-1a9.3
 
Resource Report
Resource Website 		RRID:Addgene_192717 si:ch73-1a9.3 Danio rerio Kanamycin cDNA encodes NP_001373649.1; homolog of human HMGN1 Backbone Marker:Invitrogen; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 2026-08-15 01:24:19 0
pDONR221-si:ch73-281n10.2
 
Resource Report
Resource Website 		RRID:Addgene_192716 si:ch73-281n10.2 Danio rerio Kanamycin cDNA encodes NP_001296573.1; homolog of human HMGN1 Backbone Marker:Invitrogen; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 2026-08-15 01:24:19 0
pDONR221-B3GALT5
 
Resource Report
Resource Website 		RRID:Addgene_192719 B3GALT5 Homo sapiens Kanamycin cDNA encodes NP_001265579.1 Backbone Marker:Invitrogen; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin M85T 2026-08-15 01:24:19 0
pDONR221-ets2
 
Resource Report
Resource Website 		RRID:Addgene_192724 ets2 Danio rerio Kanamycin cDNA encodes NP_001018874.1; homolog of human ETS2 Backbone Marker:Invitrogen; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin N189D (rs502796915); S231N 2026-08-15 01:24:20 0
pDONR221-get1
 
Resource Report
Resource Website 		RRID:Addgene_192722 get1 Danio rerio Kanamycin cDNA encodes NP_001003413.1; homolog of human GET1 Backbone Marker:Invitrogen; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 2026-08-15 01:24:20 0
pDONR221-kcnj6
 
Resource Report
Resource Website 		RRID:Addgene_192725 kcnj6 Danio rerio Kanamycin cDNA encodes homolog of human KCNJ6 Backbone Marker:Invitrogen; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 5' insertion of ATGGCCAAGCTGACAGAATCC, identical to human KCNJ6 2026-08-15 01:24:20 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch