Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pAKW.111A-SETD7 Resource Report Resource Website |
RRID:Addgene_154052 | Histone-lysine N-methyltransferase SETD7 | Homo sapiens | Kanamycin | Backbone Size:1974; Vector Backbone:pAJM.029; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | changed tyrosine 305 to phenylalanine | 2026-08-15 01:24:15 | 0 | ||
|
pMGU Resource Report Resource Website |
RRID:Addgene_139933 | sfGFP | Synthetic | Kanamycin | Vector Backbone:pMGU; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:24:14 | 0 | |||
|
pMGA-ptac-sfGFP Resource Report Resource Website |
RRID:Addgene_139934 | LacI-Ptac-sfGFP | Synthetic | Kanamycin | Vector Backbone:pMGA; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:24:14 | 0 | |||
|
pMGA Resource Report Resource Website |
RRID:Addgene_139931 | sfGFP | Synthetic | Kanamycin | PMID:31922737 | Vector Backbone:pMGA; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:24:14 | 0 | ||
|
pMGA-ptet-sfGFP Resource Report Resource Website |
RRID:Addgene_139935 | TetR-Ptet-sfGFP | Synthetic | Kanamycin | Vector Backbone:pMGA; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:24:14 | 0 | |||
|
pMax_mPlum Resource Report Resource Website |
RRID:Addgene_177830 | mPlum | Synthetic | Kanamycin | PMID:24757057 | For more information, see Piett, Pecen et al. 2021 Nat Protoc. (doi: 10.1038/s41596-021-00577-3). This plasmid has been found to be prone to multimerization. Multimerization often does not impact plasmid function, but it may reduce transformation efficiencies. If you need to isolate the monomeric version, you might consider linearizing, gel extracting, re-ligating, and transforming the plasmid. | Vector Backbone:pMax; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:24:15 | 0 | |
|
pSLS.436 Resource Report Resource Website |
RRID:Addgene_184953 | Eco1: ncRNA(wt) and RT | E. coli | Kanamycin | PMID:34949838 | Vector Backbone:pRSFDUET-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:24:15 | 0 | ||
|
pLY232 Resource Report Resource Website |
RRID:Addgene_184149 | s-tracrRNA-WT | Synthetic | Kanamycin | PMID:35410423 | Backbone Marker:by de Lorenzo's Lab (The Standard European Vector Architecture (SEVA) platform); Backbone Size:3821; Vector Backbone:pSEVA221; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin | 2026-08-15 01:24:17 | 0 | ||
|
pENT-L1-Kozak-Ensconsin-3XGFP-stop-L2 Resource Report Resource Website |
RRID:Addgene_186361 | Human Ensconsin | Homo sapiens | Kanamycin | PMID:17878951 | Backbone Marker:PMID: 14736459; Backbone Size:2544; Vector Backbone:PDONR-221 P1-P2; Vector Types:Expression of a fluorescent microtubule marker; Bacterial Resistance:Kanamycin | 2026-08-15 01:24:18 | 0 | ||
|
pFBP_2xNbLYS1::LUZ Resource Report Resource Website 1+ mentions |
RRID:Addgene_189918 | pLHB1B1:NnCPH:tSlH4, p35S_Short_TMV 5':AsNpga:tAtug7, pAtUbi1:NnH3H:tAtuNos, pCmYLCV:NnHisps:tHsp, p2xNbLYS1:NnLuz:tAtuOcs | Neonothopanus nambi, Nicotiana benthamiana, Aspergillus nidulans | Kanamycin | PMID:36583694 | Please visit https://www.biorxiv.org/content/10.1101/2022.07.28.501876v1 for bioRxiv preprint. | Vector Backbone:pTRANS_220d; Vector Types:Plant Expression, Luciferase; Bacterial Resistance:Kanamycin | 2026-08-15 01:24:17 | 1 | |
|
pWS5321-CRISPRai-Markerless Resource Report Resource Website |
RRID:Addgene_182828 | Kanamycin | PMID:36008396 | Vector Backbone:ColE1; Vector Types:CRISPR; Bacterial Resistance:Kanamycin | 2026-08-15 01:24:18 | 0 | ||||
|
pWS5396-CRISPRai-KanR Resource Report Resource Website |
RRID:Addgene_182835 | Kanamycin | PMID:36008396 | Vector Backbone:ColE1; Vector Types:CRISPR; Bacterial Resistance:Kanamycin | 2026-08-15 01:24:18 | 0 | ||||
|
pWS5395-CRISPRai-LYS2 Resource Report Resource Website |
RRID:Addgene_182834 | Kanamycin | PMID:36008396 | Vector Backbone:ColE1; Vector Types:CRISPR; Bacterial Resistance:Kanamycin | 2026-08-15 01:24:18 | 0 | ||||
|
pWS5399-CRISPRai-ZeoR Resource Report Resource Website |
RRID:Addgene_182838 | Kanamycin | PMID:36008396 | Vector Backbone:ColE1; Vector Types:CRISPR; Bacterial Resistance:Kanamycin | 2026-08-15 01:24:18 | 0 | ||||
|
pDONR221-si:ch73-1a9.3 Resource Report Resource Website |
RRID:Addgene_192717 | si:ch73-1a9.3 | Danio rerio | Kanamycin | cDNA encodes NP_001373649.1; homolog of human HMGN1 | Backbone Marker:Invitrogen; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-15 01:24:19 | 0 | ||
|
pDONR221-si:ch73-281n10.2 Resource Report Resource Website |
RRID:Addgene_192716 | si:ch73-281n10.2 | Danio rerio | Kanamycin | cDNA encodes NP_001296573.1; homolog of human HMGN1 | Backbone Marker:Invitrogen; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-15 01:24:19 | 0 | ||
|
pDONR221-B3GALT5 Resource Report Resource Website |
RRID:Addgene_192719 | B3GALT5 | Homo sapiens | Kanamycin | cDNA encodes NP_001265579.1 | Backbone Marker:Invitrogen; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | M85T | 2026-08-15 01:24:19 | 0 | |
|
pDONR221-ets2 Resource Report Resource Website |
RRID:Addgene_192724 | ets2 | Danio rerio | Kanamycin | cDNA encodes NP_001018874.1; homolog of human ETS2 | Backbone Marker:Invitrogen; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | N189D (rs502796915); S231N | 2026-08-15 01:24:20 | 0 | |
|
pDONR221-get1 Resource Report Resource Website |
RRID:Addgene_192722 | get1 | Danio rerio | Kanamycin | cDNA encodes NP_001003413.1; homolog of human GET1 | Backbone Marker:Invitrogen; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-15 01:24:20 | 0 | ||
|
pDONR221-kcnj6 Resource Report Resource Website |
RRID:Addgene_192725 | kcnj6 | Danio rerio | Kanamycin | cDNA encodes homolog of human KCNJ6 | Backbone Marker:Invitrogen; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | 5' insertion of ATGGCCAAGCTGACAGAATCC, identical to human KCNJ6 | 2026-08-15 01:24:20 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.