Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pcDNA3.1 Flag YFP hNKCC1 C630A (NT399) Resource Report Resource Website |
RRID:Addgene_49071 | human NKCC1 (synthetic) | Homo sapiens | Ampicillin | PMID:24339991 | Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct. | Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | C630A in hNKCC1 in NT17 | 2026-08-15 01:15:57 | 0 |
|
pEMS1977 Resource Report Resource Website |
RRID:Addgene_49109 | ssAAV-Ple251-icre | Synthetic | Ampicillin | PMID:30062914 | See publication listed below for more details about the use of this plasmid and the expression pattern of iCre under the Ple251 promoter. Please see the annotated GenBank file and the additional image file for the specific location of the minipromoter in this plasmid. | Vector Backbone:AAV2; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:56 | 0 | |
|
pcDNA3.1 Flag YFP hNKCC1 HA-ECL4 (NT935) Resource Report Resource Website |
RRID:Addgene_49065 | human NKCC1 (synthetic) | Homo sapiens | Ampicillin | PMID:24339991 | Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct. | Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2xHA epitope in ECL4 inserted at aa574 in hNKCC1 in NT17 | 2026-08-15 01:15:56 | 0 |
|
pcDNA3.1 Flag YFP hNKCC1 HA-ECL3 (NT933) Resource Report Resource Website |
RRID:Addgene_49064 | human NKCC1 (synthetic) | Homo sapiens | Ampicillin | PMID:24339991 | Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct. | Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2xHA epitope in ECL3 inserted at aa460 in hNKCC1 in NT17 | 2026-08-15 01:15:56 | 0 |
|
pcDNA3.1 Flag YFP hNKCC1 HA-ECL2 (NT931) Resource Report Resource Website 1+ mentions |
RRID:Addgene_49063 | human NKCC1 (synthetic) | Homo sapiens | Ampicillin | PMID:24339991 | Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct. | Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2xHA epitope in ECL2 inserted at aa398 in hNKCC1 in NT17 | 2026-08-15 01:15:56 | 2 |
|
pcDNA3.1 Flag YFP hNKCC1 C543M (NT360) Resource Report Resource Website |
RRID:Addgene_49068 | human NKCC1 (synthetic) | Homo sapiens | Ampicillin | PMID:24339991 | Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct. | Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | C543M in hNKCC1 in NT17 | 2026-08-15 01:15:56 | 0 |
|
pAAV-FLEX-C-RG Resource Report Resource Website 1+ mentions |
RRID:Addgene_49101 | Cerulean-E2A-RG | rabies virus | Ampicillin | GFP-2A-TVA in pAAV-EF1a-Flex-GTB is replaced with cerulean. | Backbone Marker:Callaway Addgene 26197; Vector Backbone:pAAV-EF1a-FLEX-GTB; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:56 | 3 | ||
|
AAV GFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_49055 | eGFP | Aequorea victoria green | Ampicillin | PMID:11842206 | Expression of GFP is driven by a CMV promoter with a splice donor/acceptor sequence (SD/SA) and flanked by inverted terminal repeats (ITRs). | Backbone Size:6204; Vector Backbone:adeno-associated viral (AAVsp); Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:56 | 5 | |
|
pET15b-eIF4E Resource Report Resource Website |
RRID:Addgene_37228 | eIF4E | Saccharomyces cerevisiae | Ampicillin | PMID:20864040 | Backbone Marker:EMD bioscience; Backbone Size:5700; Vector Backbone:pET15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:13 | 0 | ||
|
pET15b-eIF4E-S200C Resource Report Resource Website |
RRID:Addgene_37229 | eIF4E | Saccharomyces cerevisiae | Ampicillin | PMID:20864040 | Backbone Marker:EMD bioscience; Backbone Size:5700; Vector Backbone:pET15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | S200C | 2026-08-15 01:14:13 | 0 | |
|
pCMV-Tag2B EDD Resource Report Resource Website 10+ mentions |
RRID:Addgene_37188 | EDD | Homo sapiens | Kanamycin | PMID:12011095 | Addgene NGS results identified a K503R mutation within the UBR5 translation. There is no information on the functional consequence of this mutation | Backbone Marker:Stratagene; Backbone Size:4373; Vector Backbone:pCMV-Tag2B; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | Please see Depositor Comments | 2026-08-15 01:14:13 | 15 |
|
pMGAHisTev5B Resource Report Resource Website |
RRID:Addgene_37221 | eIF5B | Saccharomyces cerevisiae | Kanamycin | PMID:17913637 | Vector Backbone:pSKB3; Vector Types:; Bacterial Resistance:Kanamycin | N-term truncation (contains aa 396-1002) | 2026-08-15 01:14:13 | 0 | |
|
pUC19-HHtRNA Resource Report Resource Website |
RRID:Addgene_37222 | HHtRNA | Saccharomyces cerevisiae | Ampicillin | PMID:17913637 | HHtRNA sequence (rev orientation): TGGTAGCGCCGCTCGGTTTCGATCCGAGGACATCAGGGTTATGAGCCCTGCGCGCTTCCACTGCGCCACGGCGCTGACGGTACCGGGTACCGTTTCGTCCTCACGGACTCATCAGAGCG | Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:13 | 0 | |
|
pET PPL His6 MBP LIC cloning vector (2K-T) Resource Report Resource Website 1+ mentions |
RRID:Addgene_37183 | Ampicillin | This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. All 2-series vectors work as single-expression vectors, as well as transfer vectors for our polycistronic system. 2K-T has a TEV-cleavable N-terminal His6 and MBP fusion tag to enhance solubility and ease purification. These tags are preceded by a periplasmic locator signal, which is autocleaved during secretion. The PPL tag may be helpful if your protein binds to or interferes with intracellular E. coli molecules, since your protein of interest is safely sequestered in the periplasm. It may also be helpful if your protein of interest is more stable in the periplasmic environment. Protein purification may also be made simpler using this expression method. The LIC cloning site is flanked by 5 pairs of restriction sites, so that your gene can easily be subcloned into our polycistronic destination vectors (2D, 2E, or 2Z). To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:6025; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:13 | 3 | ||||
|
pCAG-T7-TALEN(Sangamo)-Destination Resource Report Resource Website 1+ mentions |
RRID:Addgene_37184 | Ampicillin | PMID:24747757 | For more information on Pelczar TALEN Add-On Plasmids please refer to: http://www.addgene.org/TALeffector/goldengate/add-ons/#pelczar | Backbone Marker:CLONTECH; Backbone Size:4810; Vector Backbone:pDIRECT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:13 | 3 | |||
|
pEGFP-C1 EDD Resource Report Resource Website 1+ mentions |
RRID:Addgene_37190 | EDD | Homo sapiens | Kanamycin | PMID:12011095 | Backbone Marker:Clontech; Backbone Size:4708; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:13 | 4 | ||
|
pSG5 EDD C2768A Resource Report Resource Website |
RRID:Addgene_37192 | EDD C2768A | Homo sapiens | Ampicillin | PMID:12011095 | The depositing lab has noted that mutation K503R shouldn’t be a problem as it is outside the main functional domains. There does appear to be a relatively common SNP at K503 in Latino populations so this might be a genuine SNP- http://exac.broadinstitute.org/variant/8-103338864-C-T https://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=rs571861064 | Backbone Marker:Stratagene; Backbone Size:4225; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Changed Cysteine 2768 to Alanine; K503R (please see depositor comments below) | 2026-08-15 01:14:13 | 0 |
|
pTYB2-eIF1 Resource Report Resource Website |
RRID:Addgene_37217 | eIF1 | Saccharomyces cerevisiae | Ampicillin | PMID:17913637 | Backbone Marker:NEB; Backbone Size:7474; Vector Backbone:pTYB2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:13 | 0 | ||
|
pTYB2-eIF5 Resource Report Resource Website |
RRID:Addgene_37219 | eIF5 | Saccharomyces cerevisiae | Ampicillin | PMID:17913637 | Backbone Marker:NEB; Backbone Size:7474; Vector Backbone:pTYB2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:13 | 0 | ||
|
mZO1-1 shRNA Resource Report Resource Website 1+ mentions |
RRID:Addgene_37215 | mouse ZO-1 shRNA | Mus musculus | Ampicillin | pLL5.0 derived from pLL3.7; CMV promoter replaced with 5' LTR promoter from pMSCV. | Backbone Size:7700; Vector Backbone:pLL5.0; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:13 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
