Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 356 showing 7101 ~ 7120 out of 740,017 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_37216

http://www.addgene.org/37216

Species: Mus musculus
Genetic Insert: mouse ZO-1 shRNA
Vector Backbone Description: Backbone Size:7700; Vector Backbone:pLL5.0; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin
Comments: pLL5.0 derived from pLL3.7; CMV promoter replaced with 5' LTR promoter from pMSCV.

Proper citation: RRID:Addgene_37216 Copy   


  • RRID:Addgene_37176

http://www.addgene.org/37176

Genetic Insert: None
Vector Backbone Description: Vector Backbone:pUX3236; Vector Types:; Bacterial Resistance:Ampicillin
Comments: This strain contains Roberts lab plasmid pUX3236 which is pUX2424 (contains ~1200bp fragment from Burkholderia xenovorans LB400 with introduced terminal HindIII and SalI sites [such that HindIII – (<-rcoM1– intergenic region – coxM1′->) – SalI]) but with a higher-affinity “e↑” binding site (5′-TCCTACAGTTCACGCACGT-3′). Suitable template for amplification and mutagenesis. For strain usage see attached pdf. Please note that this strain has not been confirmed by Addgene functionally.

Proper citation: RRID:Addgene_37176 Copy   


  • RRID:Addgene_37177

http://www.addgene.org/37177

Species: Burkholderia xenovorans
Genetic Insert: coxM1′::lacZ reporter system with higher-affinity RcoM1 binding site at the "e" position AND RcoM1 with C-term 6xHIS
Vector Backbone Description: Vector Backbone:pUX3242 and pUX2410; Vector Types:; Bacterial Resistance:Ampicillin and Kanamycin
Comments: This is Roberts lab strain UQ5853 (Addgene #37159) containing Roberts lab plasmids pUX3242 (pUX2996 with a coxM1′::lacZ reporter system such that ...vector DNA – BamHI (unique site) – higher-affinity binding site at the “e” position (“e↑” binding site = 5′-TCCTACAGTTCACGCACGT-3′) – coxM1′(with unique SalI site)::lacZ-> tfd <-KanR (with 5′-end unique XhoI site) – vector DNA <-SpR...) AND pUX2410 (for expression of Burkholderia xenovorans RcoM1 protein + C-terminal 6×His tag). The strain is CmR, pUX3242 is KanR and SpecR and pUX2410 is AmpR. Can be grown in Amp + Kan. For strain usage see attached pdf.

Proper citation: RRID:Addgene_37177 Copy   


  • RRID:Addgene_37210

http://www.addgene.org/37210

Species: canine
Genetic Insert: dog ZO-2 shRNA
Vector Backbone Description: Backbone Size:3176; Vector Backbone:pSUPER; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19605556

Proper citation: RRID:Addgene_37210 Copy   


  • RRID:Addgene_37178

http://www.addgene.org/37178

Genetic Insert: coxM1′::lacZ reporter system with RcoM binding sites "a-f" spaced at 21bp AND RcoM1 with C-term 6xHIS tag
Vector Backbone Description: Vector Backbone:pUX3254 AND pUX2410; Vector Types:; Bacterial Resistance:Ampicillin and Kanamycin
Comments: This is Roberts lab strain UQ5853 (Addgene #37159) containing Roberts lab plasmids pUX3254 (coxM1′::lacZ reporter system with binding sites “a-f” with a deletion between the “c” and “d” binding motifs such that the individual binding motifs “a,” “b,” “c,” “d,” “e,” and “f” are spaced at 21-bp intervals) AND pUX2410 (for expression of Burkholderia xenovorans RcoM1 protein + C-terminal 6×His tag). Strain is CmR, pUX3254 is KanR and SpecR, pUX2410 is AmpR. Can be grown in Amp + Kan. For strain usage see attached pdf.

Proper citation: RRID:Addgene_37178 Copy   


  • RRID:Addgene_37211

http://www.addgene.org/37211

Species: canine
Genetic Insert: dog ZO-2 shRNA
Vector Backbone Description: Backbone Size:3176; Vector Backbone:pSUPER; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19605556

Proper citation: RRID:Addgene_37211 Copy   


  • RRID:Addgene_37179

http://www.addgene.org/37179

Genetic Insert: coxM1′::lacZ reporter system of pUX3009 with an improved −35/ −10 RNAP binding region AND RcoM1 with C-term 6xHIS tag
Vector Backbone Description: Vector Backbone:pUX3272 AND pUX2410; Vector Types:; Bacterial Resistance:Ampicillin and Kanamycin
Comments: This is Roberts lab strain UQ5853 (Addgene #37159) containing Roberts lab plasmids pUX3272 (pUX3009 based coxM1′::lacZ reporter system with binding sites “d + e + f” and an improved −35/−10 RNAP binding region (5′-TTGACA-(18N)-TATCCT-3′) ) AND pUX2410 (for expression of Burkholderia xenovorans RcoM1 protein + C-terminal 6×His tag). Strain is CmR, pUX3272 is KanR and SpecR, pUX2410 is AmpR. Can be grown in Amp + Kan. For strain usage see attached pdf.

Proper citation: RRID:Addgene_37179 Copy   


  • RRID:Addgene_37173

http://www.addgene.org/37173

Genetic Insert: ~5-kb BamHI + XhoI fragment from pUX2996 cloned into BamHI + SalI-cut pEXT20
Vector Backbone Description: Vector Backbone:pUX3025; Vector Types:; Bacterial Resistance:Ampicillin
Comments: This strain contains Roberts lab plasmid pUX3025 which contains ~5-kb BamHI + XhoI fragment from pUX2996 cloned into BamHI + SalI-cut pEXT20. Useful for mutagenesis and excision of the “e + f” binding region. For strain usage details see attached pdf. Please note that this strain has not been tested functionally by Addgene.

Proper citation: RRID:Addgene_37173 Copy   


  • RRID:Addgene_37175

http://www.addgene.org/37175

Genetic Insert: ~5-kb BamHI + XhoI fragment from pUX3010 cloned into BamHI + SalI-cut pEXT20
Vector Backbone Description: Vector Backbone:pUX3057; Vector Types:; Bacterial Resistance:Ampicillin
Comments: This strain contains Roberts lab plasmid pUX3057 which contains ~5-kb BamHI + XhoI fragment from pUX3010 cloned into BamHI + SalI-cut pEXT20. Useful for mutagenesis and excision of the “a-f” binding region. For strain usage details see attached pdf. Please note that Addgene has not tested this strain functionally.

Proper citation: RRID:Addgene_37175 Copy   


  • RRID:Addgene_37180

http://www.addgene.org/37180

Genetic Insert: coxM1′::lacZ reporter system of pUX3009 with “e” binding site “TTnnnG” motif changed to “GGnnnG” AND RcoM1 with C-term 6xHIS tag
Vector Backbone Description: Vector Backbone:pUX3297 AND pUX2410; Vector Types:; Bacterial Resistance:Ampicillin and Kanamycin
Comments: This is Roberts lab strain UQ5853 (Addgene #37159) containing Roberts lab plasmids pUX3297 (pUX3009 based coxM1′::lacZ reporter system with binding sites “d + e + f” with the “e” binding site “TTnnnG” motif changed to “GGnnnG;”) AND pUX2410 (for expression of Burkholderia xenovorans RcoM1 protein + C-terminal 6×His tag). Strain is CmR, pUX3297 is KanR and SpecR, pUX2410 is AmpR. Can be grown in Amp + Kan. For strain usage see attached pdf.

Proper citation: RRID:Addgene_37180 Copy   


  • RRID:Addgene_37206

    This resource has 1+ mentions.

http://www.addgene.org/37206

Species: canine
Genetic Insert: dog ZO-1 shRNA
Vector Backbone Description: Backbone Size:3176; Vector Backbone:pSUPER; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19605556

Proper citation: RRID:Addgene_37206 Copy   


  • RRID:Addgene_37169

http://www.addgene.org/37169

Genetic Insert: coxM1′::lacZ reporter system with RcoM binding site "f" AND RcoM1 with C-term 6xHIS tag
Vector Backbone Description: Vector Backbone:pUX3008 AND pUX2410; Vector Types:; Bacterial Resistance:Ampicillin and Kanamycin
Comments: This is Roberts lab strain UQ5853 (Addgene #37159) containing Roberts lab plasmids pUX3008 (coxM1′::lacZ reporter system with binding site “f”) AND pUX2410 (for expression of Burkholderia xenovorans RcoM1 protein + C-terminal 6×His tag). Strain is CmR, pUX3008 is KanR and SpecR, pUX2410 is AmpR. Can be grown in Amp + Kan. For strain usage see attached pdf.

Proper citation: RRID:Addgene_37169 Copy   


  • RRID:Addgene_37202

    This resource has 1+ mentions.

http://www.addgene.org/37202

Species: Homo sapiens
Genetic Insert: A2BR
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEYFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21628448
Comments: A2B was PCR amplified as a 1068bp fragment incorporating a 5' EcoRI site. The stop codon was eliminated and a 3' BamHI site was added with the reverse PCR primer to allow direct cloning into pEYFP-N1

Proper citation: RRID:Addgene_37202 Copy   


  • RRID:Addgene_37167

http://www.addgene.org/37167

Genetic Insert: coxM1′::lacZ reporter system AND Burkholderia xenovorans RcoM1 with C-term 6xHIS tag
Vector Backbone Description: Vector Backbone:pUX2996 and pUX2410; Vector Types:; Bacterial Resistance:Ampicillin and Kanamycin
Comments: This is Roberts lab strain UQ5853 (Addgene #37159) containing Roberts lab plasmids pUX2996 (pUX2970 with a coxM1′::lacZ reporter system such that ...vector DNA – BamHI (unique site) – “e + f” binding region – coxM1′(with unique SalI site)::lacZ-> tfd <-KanR (with 5′-end unique XhoI site) – vector DNA <-SpR...) AND pUX2410 (for expression of Burkholderia xenovorans RcoM1 protein + C-terminal 6×His tag). Strain is CmR, plasmid pUX2996 is KanR and SpecR and plasmid is pUX2410 is AmpR. Can be grown in media containing Amp + Kan. For strain usage see attached pdf. Please note that this strain has not been tested functionally by Addgene.

Proper citation: RRID:Addgene_37167 Copy   


  • RRID:Addgene_37200

    This resource has 10+ mentions.

http://www.addgene.org/37200

Species: Mus musculus
Genetic Insert: Rosa26 left targeting arm
Vector Backbone Description: Backbone Marker:Sigma; Vector Backbone:pZDonor AAVS1; Vector Types:Genomic targeting - zinc finger; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22169954
Comments: The homology arms in the ROSA26 donor vector were generated by PCR of mouse genomic DNA and insertion of the PCR-amplified right homology arm (left primer: 5-TTATTGCGGCCGCAG ATGGGCGGGAGTCTTCT-3, right primer: 5-AACA CCGCGGCAGTTTATAAATGGAGAAAAAGGAGA -3) between the NotI and SacII sites and the left homology arm (left primer: 5-TCTATGGTACCAGTTAACGGCA GCCGGAGT-3 , right primer: 5 -CGGACGAATTCTCT AGAAAGACTGGAGTTGCAGA-3) between the KpnI and EcoRI sites in the pZDonor AAVS1 vector obtained from Sigma–Aldrich.

Proper citation: RRID:Addgene_37200 Copy   


  • RRID:Addgene_37161

http://www.addgene.org/37161

Species: Burkholderia xenovorans
Genetic Insert: rcoM2 in pEXT20
Vector Backbone Description: Vector Backbone:pEXT20; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18326575
Comments: This strain contains Roberts lab plasmid pUX2397 which contains an EcoRI-HindIII fragment bearing Burkholderia xenovorans LB400 rcoM2 cloned into pEXT20. Suitable for expression of Burkholderia xenovorans RcoM2 protein (untagged). Host strain is E. coli VJS6737. For strain usage see attached pdf.

Proper citation: RRID:Addgene_37161 Copy   


  • RRID:Addgene_37162

http://www.addgene.org/37162

Species: Burkholderia xenovorans
Genetic Insert: rcoM1 in pEXT20
Vector Backbone Description: Vector Backbone:pUX2410; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18326575
Comments: This strain contains Roberts lab plasmid pUX2410 which is an pUX2396 derivative suitable for expression of Burkholderia xenovorans RcoM1 protein + C-terminal 6×His tag. Host strain is E. coli VJS6737. For strain usage see attached pdf.

Proper citation: RRID:Addgene_37162 Copy   


  • RRID:Addgene_37164

http://www.addgene.org/37164

Species: Burkholderia xenovorans
Genetic Insert: ~1200-bp fragment from Burkholderia xenovorans LB400 cloned into pEXT20
Vector Backbone Description: Vector Backbone:pUX2442; Vector Types:; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:18326575
Comments: This strain contains Roberts lab plasmid pUX2442 which contains ~1200bp fragment from Burkholderia xenovorans LB400 with introduced terminal HindIII and SalI sites [such that HindIII – (<-rcoM1 – intergenic region – coxM1′->) – SalI] cloned into pEXT20 with the lacZ + KanR cassette from pKOK6 cloned at the SalI site such that coxM1′::lacZ->tfd<-KanR. Suitable template for amplification of the Burkholderia xenovorans RcoM1 binding region + reporter cassette. For strain usage see attached pdf.

Proper citation: RRID:Addgene_37164 Copy   


  • RRID:Addgene_37170

http://www.addgene.org/37170

Genetic Insert: coxM1′::lacZ reporter system with RcoM binding sites "d + e + f"
Vector Backbone Description: Vector Backbone:pUX3009; Vector Types:; Bacterial Resistance:Kanamycin
Comments: This is Roberts lab strain UQ5853 (Addgene #37159) containing Roberts lab plasmid pUX3009 (pUX2996 based coxM1′::lacZ reporter system with RcoM binding sites "d + e + f"). Strain is CmR, pUX3007 is KanR and SpecR. Can be grown on Kan only. For strain usage see attached pdf.

Proper citation: RRID:Addgene_37170 Copy   


  • RRID:Addgene_37171

http://www.addgene.org/37171

Genetic Insert: coxM1′::lacZ reporter system with RcoM binding sites "d + e + f" AND RcoM1 with C-term 6xHIS tag
Vector Backbone Description: Vector Backbone:pUX3009 AND pUX2410; Vector Types:; Bacterial Resistance:Ampicillin and Kanamycin
Comments: This is Roberts lab strain UQ5853 (Addgene #37159) containing Roberts lab plasmids pUX3009 (coxM1′::lacZ reporter system with binding sites “d + e + f”) AND pUX2410 (for expression of Burkholderia xenovorans RcoM1 protein + C-terminal 6×His tag). Strain is CmR, pUX3009 is KanR and SpecR, pUX2410 is AmpR. Can be grown in Amp + Kan. For strain usage see attached pdf.

Proper citation: RRID:Addgene_37171 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X