Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 357 showing 7121 ~ 7140 out of 740,584 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_107157

http://www.addgene.org/107157

Species: Rattus norvegicus
Genetic Insert: MBP-tagged rat pyruvate kinase liver isoform
Vector Backbone Description: Backbone Size:4467; Vector Backbone:PCRT7; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31825824

Proper citation: RRID:Addgene_107157 Copy   


  • RRID:Addgene_107156

http://www.addgene.org/107156

Species: Rattus norvegicus
Genetic Insert: MBP-tagged rat pyruvate kinase liver isoform
Vector Backbone Description: Backbone Size:4467; Vector Backbone:PCRT7; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31825824

Proper citation: RRID:Addgene_107156 Copy   


  • RRID:Addgene_107175

    This resource has 1+ mentions.

http://www.addgene.org/107175

Species: Other
Genetic Insert: TurboID (BirA mutant)
Vector Backbone Description: Vector Backbone:pLX304; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30125270
Comments: Please visit https://www.biorxiv.org/content/early/2017/10/02/196980 for BioRxiv preprint

Proper citation: RRID:Addgene_107175 Copy   


  • RRID:Addgene_107205

http://www.addgene.org/107205

Species: Synthetic
Genetic Insert: PLL 2.4
Vector Backbone Description: Vector Backbone:pETMBPH; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30018322

Proper citation: RRID:Addgene_107205 Copy   


  • RRID:Addgene_107203

http://www.addgene.org/107203

Species: Synthetic
Genetic Insert: PLL 2.2
Vector Backbone Description: Vector Backbone:pETMBPH; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30018322

Proper citation: RRID:Addgene_107203 Copy   


  • RRID:Addgene_107209

http://www.addgene.org/107209

Species: Synthetic
Genetic Insert: xyl3.1
Vector Backbone Description: Vector Backbone:pETMBPH; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30018322

Proper citation: RRID:Addgene_107209 Copy   


  • RRID:Addgene_107208

http://www.addgene.org/107208

Species: Synthetic
Genetic Insert: PLL 4.1
Vector Backbone Description: Vector Backbone:pETMBPH; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30018322

Proper citation: RRID:Addgene_107208 Copy   


  • RRID:Addgene_107207

http://www.addgene.org/107207

Species: Synthetic
Genetic Insert: PLL 3.1
Vector Backbone Description: Vector Backbone:pETMBPH; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30018322

Proper citation: RRID:Addgene_107207 Copy   


  • RRID:Addgene_107142

http://www.addgene.org/107142

Species: Mus musculus
Genetic Insert: SSeCKs T751A
Vector Backbone Description: Backbone Size:5198; Vector Backbone:pBABE; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29282278

Proper citation: RRID:Addgene_107142 Copy   


  • RRID:Addgene_107140

    This resource has 1+ mentions.

http://www.addgene.org/107140

Species: Homo sapiens
Genetic Insert: HA-tagged Kras4B(G12V) and GFP
Vector Backbone Description: Backbone Size:11261; Vector Backbone:pLVET-IRES-GFP; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28604746
Comments: K-RasG12V PCR:ed from pLenti-PGK-KRAS4B(G12V)(Addgene #35633) and ligated as PmeI/BamHI fragment into pLVET-IRES-GFP

Proper citation: RRID:Addgene_107140 Copy   


  • RRID:Addgene_107139

    This resource has 1+ mentions.

http://www.addgene.org/107139

Vector Backbone Description: Backbone Marker:Derived from pLVET-tTR-KRAB by P. Aebisher/D. Trono (Addgene plasmid #11644); Backbone Size:11261; Vector Backbone:pLVET; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28604746
Comments: pLVET-GFP-tTR-KRAB vector (Addgene#11644) was modified by first removing tTR-KRAB with EcoRI then ligating IRES-GFP from pMSCV PIG (Addgene #21654) as a blunt end PCR fragment into previously generated pLVET-GFP cut with SmaI. Finally original GFP was removed with EcoRI/MluI => ends blunted and vector religated to generate pLVET-IRES-GFP.

Proper citation: RRID:Addgene_107139 Copy   


http://www.addgene.org/107137

Genetic Insert: kin-2a(G310D)::SL2::GFP
Vector Backbone Description: Vector Backbone:pHW394; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29581308

Proper citation: RRID:Addgene_107137 Copy   


http://www.addgene.org/107136

Genetic Insert: NLS::gp41-1-C-intein::cGAL(AD)
Vector Backbone Description: Vector Backbone:pHW393; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29581308

Proper citation: RRID:Addgene_107136 Copy   


http://www.addgene.org/107135

Genetic Insert: NLS::gp41-1-C-intein::cGAL(AD)
Vector Backbone Description: Vector Backbone:pHW393; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29581308

Proper citation: RRID:Addgene_107135 Copy   


http://www.addgene.org/107134

Genetic Insert: NLS::cGAL(DBD)::gp41-1-N-intein
Vector Backbone Description: Vector Backbone:pHW393; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29581308

Proper citation: RRID:Addgene_107134 Copy   


http://www.addgene.org/107133

Genetic Insert: NLS::cGAL(DBD)::gp41-1-N-intein
Vector Backbone Description: Vector Backbone:pHW393; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29581308

Proper citation: RRID:Addgene_107133 Copy   


http://www.addgene.org/107132

Genetic Insert: NLS::cGAL(DBD)::gp41-1-N-intein
Vector Backbone Description: Vector Backbone:pHW393; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29581308

Proper citation: RRID:Addgene_107132 Copy   


http://www.addgene.org/107149

Species: Homo sapiens
Genetic Insert: neurofibromin 2
Vector Backbone Description: Backbone Marker:GE Life Sciences; Vector Backbone:pGEX-6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29626191
Comments: GST tag in frame with NF2 gene Note: The NFS insert contains A190V and G302E mutations compared to the closest reference sequence (NP_000259.1). The depositor has confirmed that these do not affect plasmid function.

Proper citation: RRID:Addgene_107149 Copy   


  • RRID:Addgene_107146

    This resource has 1+ mentions.

http://www.addgene.org/107146

Species: Mus musculus
Genetic Insert: Ezh2
Vector Backbone Description: Backbone Size:6573; Vector Backbone:MSCV-IRES-GFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_107146 Copy   


  • RRID:Addgene_107145

    This resource has 10+ mentions.

http://www.addgene.org/107145

Species: Synthetic
Genetic Insert: GFP + sgRNA for GFP
Vector Backbone Description: Vector Backbone:pXPR_047; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Comments: gRNA sequence is GGTGAACCGCATCGAGCTGA pLKO TRC v2 library vector, Puro selection and eGFP expression.

Proper citation: RRID:Addgene_107145 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X