Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pGST2-Alix (360-702) Resource Report Resource Website 1+ mentions |
RRID:Addgene_17639 | Alix (360-702) | Homo sapiens | Ampicillin | PMID:17277784 | The vector backbone, parallel GST2, was made by replacing the polylinker of pGEX4T1 with the polylinker isolated from the baculovirus expression plasmid pFastBac (see PMID: 10024467). | Backbone Size:5000; Vector Backbone:parallel GST2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Alix V domain | 2026-08-15 01:10:58 | 1 |
|
pVRC8400-SARS-CoV-2-NTD-B.1.351-AVI Resource Report Resource Website |
RRID:Addgene_176426 | SARS-CoV-2-NTD-B.1.351 | Kanamycin | PMID:35609088 | Vector Backbone:pVRC8400; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | L18F, D80A, D215G, 242-244del, R246I | 2026-08-15 01:10:58 | 0 | ||
|
pVRC8400-SARS-CoV-2-NTD-P.1-AVI Resource Report Resource Website |
RRID:Addgene_176429 | SARS-CoV-2-NTD-P.1 | Kanamycin | PMID:35609088 | Vector Backbone:pVRC8400; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | L18F, T20N, P26S, D138Y, R190S | 2026-08-15 01:10:58 | 0 | ||
|
pNR2E3.1.0-gDNA Resource Report Resource Website |
RRID:Addgene_176386 | NR2E3 gRNA | Homo sapiens | Ampicillin | gRNA sequence listed also includes (uncloned) PAM | Backbone Marker:addgene ID: 42230; Vector Backbone:pX330; Vector Types:CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:58 | 0 | ||
|
pZC3H10.1.0-gDNA Resource Report Resource Website |
RRID:Addgene_176385 | ZC3H10 gRNA | Homo sapiens | Ampicillin | gRNA sequence listed also includes (uncloned) PAM | Backbone Marker:addgene ID: 42230; Vector Backbone:pX330; Vector Types:CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:58 | 0 | ||
|
pVRC8400-SARS-CoV-2-NTD-B.1.1.7-AVI Resource Report Resource Website |
RRID:Addgene_176424 | SARS-CoV-2-NTD-B.1.1.7 | Kanamycin | PMID:35609088 | Vector Backbone:pVRC8400; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 69-70 del, 144del | 2026-08-15 01:10:58 | 0 | ||
|
pcDNA3-myc-his-BACH1 K52R Resource Report Resource Website 1+ mentions |
RRID:Addgene_17643 | BACH1 | Homo sapiens | Ampicillin | PMID:14983014 | Backbone Marker:Invitrogen; Backbone Size:5493; Vector Backbone:pcDNA3.1(+)/myc-His A; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | The lysine residue at position 52 was changed to an arginine, using a Quik-change site-directed mutagenesis kit (Stratagene). | 2026-08-15 01:10:58 | 2 | |
|
pTRERF1.1.0-gDNA Resource Report Resource Website |
RRID:Addgene_176384 | TRERF1 gRNA | Homo sapiens | Ampicillin | gRNA sequence listed also includes (uncloned) PAM | Backbone Marker:addgene ID: 42230; Vector Backbone:pX330; Vector Types:CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:58 | 0 | ||
|
pGEM-Isce-Tol2-Tn5-neo Resource Report Resource Website |
RRID:Addgene_176619 | I-SceI sites, Tol2 repeats and Tn5-neo cassette | Synthetic | Ampicillin and Kanamycin | PMID:34751773 | Backbone Marker:Promega; Backbone Size:3000; Vector Backbone:pGEM-T; Vector Types:Unspecified; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:11:00 | 0 | ||
|
pET29b-mVenus-dspB(E184Q W330Y)-6xHis Resource Report Resource Website 1+ mentions |
RRID:Addgene_176577 | Dispersin B | Aggregatibacter actinomycetemcomitans | Kanamycin | PMID:35379435 | Backbone Size:5313; Vector Backbone:pET29b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | E184Q W330Y | 2026-08-15 01:11:00 | 1 | |
|
Cry2PHR-IBAR-WH2 Resource Report Resource Website |
RRID:Addgene_176603 | Cry2PHR-mCherry-IBAR-WH2 | Homo sapiens | Kanamycin | PMID:35987384 | Please visit https://www.biorxiv.org/content/10.1101/2022.01.28.478241v1 for bioRxiv preprint. | Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:11:00 | 0 | |
|
IBAR-Cry2PHR Resource Report Resource Website |
RRID:Addgene_176604 | IBAR-Cry2PHR-mCherry | Homo sapiens | Kanamycin | PMID:35987384 | Please visit https://www.biorxiv.org/content/10.1101/2022.01.28.478241v1 for bioRxiv preprint. | Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:11:00 | 0 | |
|
pM-TagRFP657 Resource Report Resource Website |
RRID:Addgene_176563 | TagRFP657 | Synthetic | Ampicillin | PMID:35314781 | Please note: Plasmid contains E38G and L304S mutations in MET17. These mutations are not known to affect plasmid function. | Vector Backbone:pM; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:11:00 | 0 | |
|
pH-TagRFP657 Resource Report Resource Website |
RRID:Addgene_176560 | TagRFP657 | Synthetic | Ampicillin | PMID:35314781 | Vector Backbone:pH; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:11:00 | 0 | ||
|
pSL1180-HR-PUbEGFP-NLS Resource Report Resource Website |
RRID:Addgene_176681 | EGFP | Ae. Aegypti, Aequorea victoria | Ampicillin | PMID:34819517 | Please visit https://www.biorxiv.org/content/10.1101/2021.03.29.437496v2 for bioRxiv preprint. | Vector Backbone:pSL1180; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:11:01 | 0 | |
|
MF87_PB-EF1a-TET3G-P2A-ERT2-Gal4-BGHpA Resource Report Resource Website |
RRID:Addgene_176630 | EF1a-TET3G-P2A-ERT2-Gal4-BGHpA | Synthetic | Ampicillin | PMID:35050677 | Backbone Marker:System Biosciences; Vector Backbone:PiggyBac transposon system; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:11:00 | 0 | ||
|
MF82_PB-TRE3G-12x42bs-10x(BCRbs_BCRbs)-miniCMV-NLS-FKBP12F36V-BCRZFR39A-VP16-NLS-DHFR-IRES-mCherry-PEST-BGHpA Resource Report Resource Website |
RRID:Addgene_176626 | TRE3G-12x42bs-10x(BCRbs_BCRbs)-miniCMV-NLS-FKBP12F36V-BCRZFR39A-VP16-NLS-DHFR-IRES-mCherry-PEST-BGHpA | Synthetic | Ampicillin | PMID:35050677 | Backbone Marker:System Biosciences; Vector Backbone:PiggyBac transposon system; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:11:00 | 0 | ||
|
MF85_PB-14xUAS-12x42bs-10x(ErbB2bs_ErbB2bs)-miniCMV-NLS-FKBP12F36V-ErbB2ZFR2AR39A-VP16-NLS-DHFR-IRES-mTurquoise2-PEST-BGHpA Resource Report Resource Website |
RRID:Addgene_176629 | 14xUAS-12x42bs-10x(ErbB2bs_ErbB2bs)-miniCMV-NLS-FKBP12F36V-ErbB2ZFR2AR39A-VP16-NLS-DHFR-IRES-mTurquoise2-PEST-BGHpA | Synthetic | Ampicillin | PMID:35050677 | Backbone Marker:System Biosciences; Vector Backbone:PiggyBac transposon system; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:11:00 | 0 | ||
|
MF84_PB-14xUAS-6x42bs-6x(BCRbs_BCRbs)-miniCMV-NLS-FKBP12F36V-BCRZFR39A-VP16-NLS-DHFR-IRES-mCherry-PEST-BGHpA Resource Report Resource Website |
RRID:Addgene_176628 | 14xUAS-6x42bs-6x(BCRbs_BCRbs)-miniCMV-NLS-FKBP12F36V-BCRZFR39A-VP16-NLS-DHFR-IRES-mCherry-PEST-BGHpA | Synthetic | Ampicillin | PMID:35050677 | Backbone Marker:System Biosciences; Vector Backbone:PiggyBac transposon system; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:11:00 | 0 | ||
|
BL21 Rosetta2 GamS Resource Report Resource Website |
RRID:Addgene_176584 | pRARE2 + pBADmod1-linker2-gamS plasmid | Chloramphenicol and Ampicillin | PMID:35034449 | Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint. Primers for genomic verification: Foward - tattttccagtcgtgaaagc Reverse - ttgctgatttcttccatcag Primers for GamS plasmid verification: Forward - aattatgacaacttgacggctacatcattc Reverse - cgttcaccgacaaacaaca | Vector Backbone:Unknown; Vector Types:; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:11:00 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
