Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: GFP
Vector Backbone Description: Backbone Size:6181; Vector Backbone:pMSCV; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27914197
Proper citation: RRID:Addgene_86537 Copy
Vector Backbone Description: Vector Backbone:pCRISPRia-v2; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27980086
Proper citation: RRID:Addgene_86538 Copy
Vector Backbone Description: Vector Backbone:pCRISPRia-v2; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27980086
Proper citation: RRID:Addgene_86539 Copy
Species: Homo sapiens
Genetic Insert: beta-catenin
Vector Backbone Description: Vector Backbone:pT3-EF1aH; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17785413
Proper citation: RRID:Addgene_86499 Copy
Species: Homo sapiens
Genetic Insert: OptoSOS
Vector Backbone Description: Backbone Size:10100; Vector Backbone:pTIGER; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28118601
Proper citation: RRID:Addgene_86439 Copy
Vector Backbone Description: Vector Backbone:pCRISPRia-v2; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27980086
Proper citation: RRID:Addgene_86540 Copy
Vector Backbone Description: Vector Backbone:pCRISPRia-v2; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27980086
Proper citation: RRID:Addgene_86543 Copy
Vector Backbone Description: Vector Backbone:pCRISPRia-v2; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27980086
Proper citation: RRID:Addgene_86544 Copy
Vector Backbone Description: Vector Backbone:pCRISPRia-v2; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27980086
Proper citation: RRID:Addgene_86541 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: CDC42pr-KAR2SS-GFP1-10
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pFA6-NATMX; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27831485
Proper citation: RRID:Addgene_86421 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: VMA intein
Vector Backbone Description: Vector Backbone:pMAL-c5X; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28186733
Comments: TGTCCTACTCAGGAGAGCGTTCAC to sequence VMA C-term; and ACCCATGACCTTATTACCAACCTC to sequence the insert between MBP C-term and VMA
Proper citation: RRID:Addgene_86590 Copy
Species: Homo sapiens
Genetic Insert: CHRNB4 (control)
Vector Backbone Description: Vector Backbone:pSuper; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19896492
Proper citation: RRID:Addgene_86651 Copy
Species: Homo sapiens
Genetic Insert: YAP
Vector Backbone Description: Backbone Marker:Upen vector core ; Vector Backbone:pAAV.cTNT.; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24833660
Comments: After plasmid preparation, a SmaI diagnose digestion is necessary to confirm if there any mutation in the ITR regions.
Proper citation: RRID:Addgene_86558 Copy
Genetic Insert: GFP-FLAG-cGAS
Vector Backbone Description: Vector Backbone:pTRIP; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27013426
Proper citation: RRID:Addgene_86675 Copy
Species: Synthetic
Genetic Insert: CANE-LV envelope
Vector Backbone Description: Backbone Size:4821; Vector Backbone:pCASGS/ES; Vector Types:Mammalian Expression, Mouse Targeting, Lentiviral, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27974160
Proper citation: RRID:Addgene_86666 Copy
Species: S. pyogenes
Genetic Insert: ATP1A1 G3 sgRNA + user-specified sgRNA + FLAGless enhanced specificity Cas9 (1.1)
Vector Backbone Description: Vector Backbone:pX330-U6-Chimeric_BB-CBh-hSpCas9; Vector Types:Mammalian Expression, CRISPR, Co-selection via HDR using ouabain; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28417998
Comments: ATP1A1 G3 gRNA target sequence is GAGTTCTGTAATTCAGCATA
Proper citation: RRID:Addgene_86613 Copy
Species: Homo sapiens
Genetic Insert: SELENOM
Vector Backbone Description: Vector Backbone:pMAL-c5X; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28186733
Proper citation: RRID:Addgene_86579 Copy
Species: S. pyogenes
Genetic Insert: ATP1A1 G2 sgRNA + user-specified sgRNA + FLAGless enhanced specificity Cas9 (1.1)
Vector Backbone Description: Vector Backbone:pX330-U6-Chimeric_BB-CBh-hSpCas9; Vector Types:Mammalian Expression, CRISPR, Co-selection via NHEJ using ouabain; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28417998
Comments: ATP1A1 G2 gRNA target sequence is gatccaagctgctacagaag.
Proper citation: RRID:Addgene_86612 Copy
Species: Mus musculus
Genetic Insert: Brd4
Vector Backbone Description: Backbone Marker:PMID: 12490204; Backbone Size:4260; Vector Backbone:pAdRSV-Sp-Flag; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22595521
Proper citation: RRID:Addgene_86616 Copy
Species: Homo sapiens
Genetic Insert: Akt1
Vector Backbone Description: Vector Backbone:pFastBac Dual; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28157504
Comments: Cloned by Iva LUCIC
Proper citation: RRID:Addgene_86563 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
