Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Issues Status:no known issues (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

740,584 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
BL21 Rosetta2 ΔrecBCD
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_176583 pRARE2 plasmid Chloramphenicol PMID:35034449 Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint. Primers for recBCD deletion verification: Foward - ttgatttactgcccgagagc Reverse - gtcaaccgaatgcagacatc Vector Backbone:Strain; Vector Types:; Bacterial Resistance:Chloramphenicol recBCD genomic deletion 2026-08-15 01:11:00 1
BL21 Rosetta2 ΔrecBCD GamS
 
Resource Report
Resource Website
RRID:Addgene_176586 pRARE2 + pBADmod1-linker2-gamS plasmid Chloramphenicol and Ampicillin PMID:35034449 Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint. Primers for recBCD deletion verification: Foward - ttgatttactgcccgagagc Reverse - gtcaaccgaatgcagacatc Primers for GamS plasmid verification: Forward - aattatgacaacttgacggctacatcattc Reverse - cgttcaccgacaaacaaca Vector Backbone:Strain; Vector Types:; Bacterial Resistance:Chloramphenicol and Ampicillin recBCD genomic deletion 2026-08-15 01:11:00 0
pHS0537 CRISPR-associated IscB locus (Delaware Bay) in pBR322 with Fn spacer
 
Resource Report
Resource Website
RRID:Addgene_176588 CRISPR-associate IscB (Delaware Bay) locus Delaware Bay metagenome Ampicillin PMID:34591643 Backbone Marker:NEB; Backbone Size:4361; Vector Backbone:pBR322; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin Replaced spacer in CRISPR array with Fn spacer 2026-08-15 01:11:00 0
BL21 Rosetta2 ΔrecB
 
Resource Report
Resource Website
RRID:Addgene_176582 pRARE2 plasmid Chloramphenicol PMID:35034449 Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint. Primers for recB deletion verification: Foward - tattttccagtcgtgaaagc Reverse - ttgctgatttcttccatcag Vector Backbone:Strain; Vector Types:; Bacterial Resistance:Chloramphenicol recB genomic deletion 2026-08-15 01:11:00 0
BL21 ΔrecBCD
 
Resource Report
Resource Website
RRID:Addgene_176581 This is a strain. None PMID:35034449 Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint. Primers for recBCD deletion verification: Foward - ttgatttactgcccgagagc Reverse - gtcaaccgaatgcagacatc Vector Backbone:Strain; Vector Types:; Bacterial Resistance:None recBCD genomic deletion 2026-08-15 01:11:00 0
pLib6.4-Aaeg_763
 
Resource Report
Resource Website
RRID:Addgene_176658 Ampicillin PMID:34819517 Cloning of sgRNA targeting sequence into BbsI cassette. Please visit https://www.biorxiv.org/content/10.1101/2021.03.29.437496v2 for bioRxiv preprint. Vector Backbone:pUC19; Vector Types:Insect Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:11:01 0
pCDH-EF1-mVenus-p27K−
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_176651 mVenus-p27K- Mus musculus Ampicillin PMID:34079127 Backbone Marker:System Biosciences; Backbone Size:7082; Vector Backbone:pCDH; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin Mutant K- (lacks affinity to Cdk) 2026-08-15 01:11:00 5
pLib6.4-Agam_557
 
Resource Report
Resource Website
RRID:Addgene_176653 Ampicillin PMID:34819517 Cloning of sgRNA targeting sequence into BbsI cassette. Please visit https://www.biorxiv.org/content/10.1101/2021.03.29.437496v2 for bioRxiv preprint. Vector Backbone:pUC19; Vector Types:Insect Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:11:00 0
pLib6.4-Cquin_728
 
Resource Report
Resource Website
RRID:Addgene_176656 Ampicillin PMID:34819517 Cloning of sgRNA targeting sequence into BbsI cassette. Please visit https://www.biorxiv.org/content/10.1101/2021.03.29.437496v2 for bioRxiv preprint. Vector Backbone:pUC19; Vector Types:Insect Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:11:00 0
pLib6.4-Cquin_596
 
Resource Report
Resource Website
RRID:Addgene_176655 Ampicillin PMID:34819517 Cloning of sgRNA targeting sequence into BbsI cassette. Please visit https://www.biorxiv.org/content/10.1101/2021.03.29.437496v2 for bioRxiv preprint. Vector Backbone:pUC19; Vector Types:Insect Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:11:01 0
Lac-I-SceI-Tet
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_17655 lac I-SceI tet Ampicillin PMID:17486118 The 256 lac operator repeats (XhoI fragment) and the 96 tet operator repeats (XhoI –SacII fragment) from the p16PCbeta plasmid (gift from D. Spector) were cloned into pBluescript. Between the two fragments a single 18nt I-SceI site was inserted (SalI). lac operator repeat: tggaattgtgagcggataacaatt tet operator repeat: tccctatcagtgatagaga This plasmid is not stable in bacteria. Every bacterial stock made will contain correct and incorrect bacteria and when bacteria are grown, you will get colonies which contain the correct plasmid and others which contain recombinant versions. If you check multiple colonies (10-20) in the samples after streaking out a stab, you should find correct ones. The recipient will need to grow the bacteria, isolate individual colonies check them, and make a prep from the correct one. We recommend processing the stab and screening colonies immediately upon receipt. Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:11:00 4
TS-PE2-N
 
Resource Report
Resource Website
RRID:Addgene_176649 N-terminus of PE2 Synthetic Ampicillin PMID:34446856 Backbone Size:3544; Vector Backbone:px601; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin 2026-08-15 01:11:00 0
pBABE-puro-GFP-wt-lamin A
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_17662 GFP-lamin A Homo sapiens Ampicillin PMID:18311132 This vector was generated by cloning the NheI–BamHI fragment from pEGFP–wt-lamin A into the BamHI site of the pBABE-puro vector after filling of the ends. Backbone Size:5200; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:11:00 45
MBP-RGG-LgBit-RGG
 
Resource Report
Resource Website
RRID:Addgene_176643 MBP-RGG-LgBit-RGG Synthetic Kanamycin PMID:34648259 Vector Backbone:pBamUK; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:11:00 0
pBABE-puro-GFP-progerin
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_17663 GFP-D50 lamin A Homo sapiens Ampicillin PMID:18311132 This vector was generated by cloning the NheI–BamHI fragment from pEGFP–D50 lamin A into the BamHI site of the pBABE-puro vector after filling of the ends. This plasmid exists as a dimer in our stock. Dimerziation often does not impact plasmid function, but may reduce transformation efficiencies. If you need the monomeric version, you could try linearizing, gel extracting, re-ligating, and transforming the plasmid. Backbone Size:5200; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin Delta 50 2026-08-15 01:11:00 23
pBABE-zeo (pBABE-bleo)
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_1766 Ampicillin PMID:2194165 Please acknowledge Jay Morgenstern and Hartmut Land and cite the following article if you use this plasmid in a publication: Morgenstern JP, Land H., 1990, Nucleic Acids Research 18(12):3587-96. SspI site in Amp gene. If you are using the pBABE protocol from the Weinberg Lab to generate virus, please note that the Weinberg Lab recommends using pUMVC (Addgene #8449) and VSV-G (#8454) for packaging. The pCL-Eco plasmid listed in their protocol should be substituted with pUMVC. Backbone Size:4888; Vector Backbone:pBABE-zeo; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:11:00 12
p43BgI
 
Resource Report
Resource Website
RRID:Addgene_17665 Cx43 3'UTR Mus musculus Ampicillin 3'UTR of Mus musculus Gja1 (Cx43). For in situ riboprobe. Anti-Sense: use SP6 and cut with ClaI. Sense: use T7 and cut with HindIII. Backbone Size:0; Vector Backbone:na; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:11:00 0
pHXPL
 
Resource Report
Resource Website
RRID:Addgene_17667 Cx43 promoter Mus musculus Ampicillin Backbone Size:7000; Vector Backbone:pPD46.20; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:11:01 0
pK-eCFP
 
Resource Report
Resource Website
RRID:Addgene_176559 eCFP Synthetic Ampicillin PMID:31367038 Vector Backbone:pK; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:11:00 0
pM-eCFP
 
Resource Report
Resource Website
RRID:Addgene_176558 eCFP Synthetic Ampicillin PMID:35314781 Vector Backbone:pM; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:11:00 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.