Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
BL21 Rosetta2 ΔrecBCD Resource Report Resource Website 1+ mentions |
RRID:Addgene_176583 | pRARE2 plasmid | Chloramphenicol | PMID:35034449 | Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint. Primers for recBCD deletion verification: Foward - ttgatttactgcccgagagc Reverse - gtcaaccgaatgcagacatc | Vector Backbone:Strain; Vector Types:; Bacterial Resistance:Chloramphenicol | recBCD genomic deletion | 2026-08-15 01:11:00 | 1 | |
|
BL21 Rosetta2 ΔrecBCD GamS Resource Report Resource Website |
RRID:Addgene_176586 | pRARE2 + pBADmod1-linker2-gamS plasmid | Chloramphenicol and Ampicillin | PMID:35034449 | Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint. Primers for recBCD deletion verification: Foward - ttgatttactgcccgagagc Reverse - gtcaaccgaatgcagacatc Primers for GamS plasmid verification: Forward - aattatgacaacttgacggctacatcattc Reverse - cgttcaccgacaaacaaca | Vector Backbone:Strain; Vector Types:; Bacterial Resistance:Chloramphenicol and Ampicillin | recBCD genomic deletion | 2026-08-15 01:11:00 | 0 | |
|
pHS0537 CRISPR-associated IscB locus (Delaware Bay) in pBR322 with Fn spacer Resource Report Resource Website |
RRID:Addgene_176588 | CRISPR-associate IscB (Delaware Bay) locus | Delaware Bay metagenome | Ampicillin | PMID:34591643 | Backbone Marker:NEB; Backbone Size:4361; Vector Backbone:pBR322; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Replaced spacer in CRISPR array with Fn spacer | 2026-08-15 01:11:00 | 0 | |
|
BL21 Rosetta2 ΔrecB Resource Report Resource Website |
RRID:Addgene_176582 | pRARE2 plasmid | Chloramphenicol | PMID:35034449 | Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint. Primers for recB deletion verification: Foward - tattttccagtcgtgaaagc Reverse - ttgctgatttcttccatcag | Vector Backbone:Strain; Vector Types:; Bacterial Resistance:Chloramphenicol | recB genomic deletion | 2026-08-15 01:11:00 | 0 | |
|
BL21 ΔrecBCD Resource Report Resource Website |
RRID:Addgene_176581 | This is a strain. | None | PMID:35034449 | Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint. Primers for recBCD deletion verification: Foward - ttgatttactgcccgagagc Reverse - gtcaaccgaatgcagacatc | Vector Backbone:Strain; Vector Types:; Bacterial Resistance:None | recBCD genomic deletion | 2026-08-15 01:11:00 | 0 | |
|
pLib6.4-Aaeg_763 Resource Report Resource Website |
RRID:Addgene_176658 | Ampicillin | PMID:34819517 | Cloning of sgRNA targeting sequence into BbsI cassette. Please visit https://www.biorxiv.org/content/10.1101/2021.03.29.437496v2 for bioRxiv preprint. | Vector Backbone:pUC19; Vector Types:Insect Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:11:01 | 0 | |||
|
pCDH-EF1-mVenus-p27K− Resource Report Resource Website 1+ mentions |
RRID:Addgene_176651 | mVenus-p27K- | Mus musculus | Ampicillin | PMID:34079127 | Backbone Marker:System Biosciences; Backbone Size:7082; Vector Backbone:pCDH; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | Mutant K- (lacks affinity to Cdk) | 2026-08-15 01:11:00 | 5 | |
|
pLib6.4-Agam_557 Resource Report Resource Website |
RRID:Addgene_176653 | Ampicillin | PMID:34819517 | Cloning of sgRNA targeting sequence into BbsI cassette. Please visit https://www.biorxiv.org/content/10.1101/2021.03.29.437496v2 for bioRxiv preprint. | Vector Backbone:pUC19; Vector Types:Insect Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:11:00 | 0 | |||
|
pLib6.4-Cquin_728 Resource Report Resource Website |
RRID:Addgene_176656 | Ampicillin | PMID:34819517 | Cloning of sgRNA targeting sequence into BbsI cassette. Please visit https://www.biorxiv.org/content/10.1101/2021.03.29.437496v2 for bioRxiv preprint. | Vector Backbone:pUC19; Vector Types:Insect Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:11:00 | 0 | |||
|
pLib6.4-Cquin_596 Resource Report Resource Website |
RRID:Addgene_176655 | Ampicillin | PMID:34819517 | Cloning of sgRNA targeting sequence into BbsI cassette. Please visit https://www.biorxiv.org/content/10.1101/2021.03.29.437496v2 for bioRxiv preprint. | Vector Backbone:pUC19; Vector Types:Insect Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:11:01 | 0 | |||
|
Lac-I-SceI-Tet Resource Report Resource Website 1+ mentions |
RRID:Addgene_17655 | lac I-SceI tet | Ampicillin | PMID:17486118 | The 256 lac operator repeats (XhoI fragment) and the 96 tet operator repeats (XhoI –SacII fragment) from the p16PCbeta plasmid (gift from D. Spector) were cloned into pBluescript. Between the two fragments a single 18nt I-SceI site was inserted (SalI). lac operator repeat: tggaattgtgagcggataacaatt tet operator repeat: tccctatcagtgatagaga This plasmid is not stable in bacteria. Every bacterial stock made will contain correct and incorrect bacteria and when bacteria are grown, you will get colonies which contain the correct plasmid and others which contain recombinant versions. If you check multiple colonies (10-20) in the samples after streaking out a stab, you should find correct ones. The recipient will need to grow the bacteria, isolate individual colonies check them, and make a prep from the correct one. We recommend processing the stab and screening colonies immediately upon receipt. | Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:11:00 | 4 | ||
|
TS-PE2-N Resource Report Resource Website |
RRID:Addgene_176649 | N-terminus of PE2 | Synthetic | Ampicillin | PMID:34446856 | Backbone Size:3544; Vector Backbone:px601; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | 2026-08-15 01:11:00 | 0 | ||
|
pBABE-puro-GFP-wt-lamin A Resource Report Resource Website 10+ mentions |
RRID:Addgene_17662 | GFP-lamin A | Homo sapiens | Ampicillin | PMID:18311132 | This vector was generated by cloning the NheI–BamHI fragment from pEGFP–wt-lamin A into the BamHI site of the pBABE-puro vector after filling of the ends. | Backbone Size:5200; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:11:00 | 45 | |
|
MBP-RGG-LgBit-RGG Resource Report Resource Website |
RRID:Addgene_176643 | MBP-RGG-LgBit-RGG | Synthetic | Kanamycin | PMID:34648259 | Vector Backbone:pBamUK; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:11:00 | 0 | ||
|
pBABE-puro-GFP-progerin Resource Report Resource Website 10+ mentions |
RRID:Addgene_17663 | GFP-D50 lamin A | Homo sapiens | Ampicillin | PMID:18311132 | This vector was generated by cloning the NheI–BamHI fragment from pEGFP–D50 lamin A into the BamHI site of the pBABE-puro vector after filling of the ends. This plasmid exists as a dimer in our stock. Dimerziation often does not impact plasmid function, but may reduce transformation efficiencies. If you need the monomeric version, you could try linearizing, gel extracting, re-ligating, and transforming the plasmid. | Backbone Size:5200; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | Delta 50 | 2026-08-15 01:11:00 | 23 |
|
pBABE-zeo (pBABE-bleo) Resource Report Resource Website 10+ mentions |
RRID:Addgene_1766 | Ampicillin | PMID:2194165 | Please acknowledge Jay Morgenstern and Hartmut Land and cite the following article if you use this plasmid in a publication: Morgenstern JP, Land H., 1990, Nucleic Acids Research 18(12):3587-96. SspI site in Amp gene. If you are using the pBABE protocol from the Weinberg Lab to generate virus, please note that the Weinberg Lab recommends using pUMVC (Addgene #8449) and VSV-G (#8454) for packaging. The pCL-Eco plasmid listed in their protocol should be substituted with pUMVC. | Backbone Size:4888; Vector Backbone:pBABE-zeo; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:11:00 | 12 | |||
|
p43BgI Resource Report Resource Website |
RRID:Addgene_17665 | Cx43 3'UTR | Mus musculus | Ampicillin | 3'UTR of Mus musculus Gja1 (Cx43). For in situ riboprobe. Anti-Sense: use SP6 and cut with ClaI. Sense: use T7 and cut with HindIII. | Backbone Size:0; Vector Backbone:na; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:11:00 | 0 | ||
|
pHXPL Resource Report Resource Website |
RRID:Addgene_17667 | Cx43 promoter | Mus musculus | Ampicillin | Backbone Size:7000; Vector Backbone:pPD46.20; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:11:01 | 0 | |||
|
pK-eCFP Resource Report Resource Website |
RRID:Addgene_176559 | eCFP | Synthetic | Ampicillin | PMID:31367038 | Vector Backbone:pK; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:11:00 | 0 | ||
|
pM-eCFP Resource Report Resource Website |
RRID:Addgene_176558 | eCFP | Synthetic | Ampicillin | PMID:35314781 | Vector Backbone:pM; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:11:00 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.