Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 359 showing 7161 ~ 7180 out of 328,858 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_50524

http://www.addgene.org/50524

Species: Mus musculus
Genetic Insert: protein tyrosine kinase, domain
Vector Backbone Description: Backbone Marker:Bruce Howard Lab, PubMed ID 1373145; Vector Backbone:pCMVIL2R(pIL2R); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:1373145
Comments: Vector contains truncated IL-2R alpha subunit without cytoplasmic domain (Tac antigen) for membrane localization and clustering

Proper citation: RRID:Addgene_50524 Copy   


  • RRID:Addgene_50488

    This resource has 1+ mentions.

http://www.addgene.org/50488

Species: Homo sapiens
Genetic Insert: TRF2
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:4378; Vector Backbone:pTrcHisB; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25115914
Comments: This set of TRF2 and TRF2 mutant vectors has been engineered reintroduce Alanine 434, which is deleted in most published TRF2 vectors, and to generate TRF2 and TRF2 mutant proteins with identical N-terminal tags.

Proper citation: RRID:Addgene_50488 Copy   


  • RRID:Addgene_50520

    This resource has 1+ mentions.

http://www.addgene.org/50520

Species: Homo sapiens
Genetic Insert: PTEN
Vector Backbone Description: Backbone Marker:Yamada Lab, Tamura et al., Science 280: 1614-7 (1998); Vector Backbone:pGZ21dxZ; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9616126

Proper citation: RRID:Addgene_50520 Copy   


  • RRID:Addgene_50523

http://www.addgene.org/50523

Species: Homo sapiens
Genetic Insert: PTEN
Vector Backbone Description: Backbone Marker:Yamada Lab, Tamura et al., Science 280: 1614-7 (1998); Vector Backbone:pGZ21dxZ; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9616126

Proper citation: RRID:Addgene_50523 Copy   


  • RRID:Addgene_50529

    This resource has 10+ mentions.

http://www.addgene.org/50529

Species: Homo sapiens
Genetic Insert: Paxillin
Vector Backbone Description: Backbone Marker:Yamada Lab, Tamura et al., Science 280: 1614-7 (1998); Vector Backbone:pGZ21dxZ; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_50529 Copy   


  • RRID:Addgene_50495

    This resource has 1+ mentions.

http://www.addgene.org/50495

Species: Homo sapiens
Genetic Insert: fibronectin
Vector Backbone Description: Vector Backbone:pVC70108; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7929152
Comments: Primers used for amplification of insert: primer A (CCATATGGGTCGACCCAACTGG), which contains an NdeI site, methionine start codon, and 5' end of the 9th type III repeat sequence, and primer B (ATGAATTCTACATCTGGGATGGTTTGTCAA), which contains an EcoRI site, a stop codon, and the 3' end of the 37-kDa fibronectin fragment.

Proper citation: RRID:Addgene_50495 Copy   


  • RRID:Addgene_50497

http://www.addgene.org/50497

Species: Homo sapiens
Genetic Insert: NM_001306129.1
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pRSETC'; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7545166

Proper citation: RRID:Addgene_50497 Copy   


  • RRID:Addgene_50496

http://www.addgene.org/50496

Species: Homo sapiens
Genetic Insert: fibronectin
Vector Backbone Description: Vector Backbone:pVC70108; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_50496 Copy   


  • RRID:Addgene_50498

http://www.addgene.org/50498

Species: Homo sapiens
Genetic Insert: fibronectin
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pRSETC'; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_50498 Copy   


  • RRID:Addgene_50539

http://www.addgene.org/50539

Species: Homo sapiens
Genetic Insert: PTEN
Vector Backbone Description: Backbone Marker:PMID 14729065; Vector Backbone:pRKVSV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_50539 Copy   


  • RRID:Addgene_50547

    This resource has 10+ mentions.

http://www.addgene.org/50547

Species: Other
Genetic Insert: MitoTimer
Vector Backbone Description: Backbone Marker:Clonetech; Backbone Size:2516; Vector Backbone:pTRE Tight; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24128932
Comments: The F12S mutation in Timer does not affect the function of the plasmid, as described in the associated publication. The Timer sequence is preceded by the mitochondrial targeting sequence from cytochrome c oxidase subunit 8A: MSVLTPLLLRGLTGSARRLPVPRAKIHSL

Proper citation: RRID:Addgene_50547 Copy   


  • RRID:Addgene_50549

    This resource has 1+ mentions.

http://www.addgene.org/50549

Species: Synthetic
Genetic Insert: mCherry
Vector Backbone Description: Backbone Marker:Registry of Standard Biological Parts; Backbone Size:3296; Vector Backbone:pSB4A3; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24608181
Comments: Note: Addgene's quality control sequencing found a few mismatches compared to the depositor's full sequence, but they should not affect plasmid function.

Proper citation: RRID:Addgene_50549 Copy   


  • RRID:Addgene_50554

    This resource has 1+ mentions.

http://www.addgene.org/50554

Species: Drosophila melanogaster
Genetic Insert: Argonaute2
Vector Backbone Description: Backbone Marker:The Drosophila Gateway™ Vector Collection; Vector Backbone:pAFW; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20605501
Comments: Please note that when compared to GenBank reference sequence NP_648775.1, the Ago2 sequence in this plasmid is missing amino acids 49-54 (LQQPQQ).

Proper citation: RRID:Addgene_50554 Copy   


http://www.addgene.org/50556

Species: Synthetic
Genetic Insert: Luciferase-let7-Poly(A)
Vector Backbone Description: Backbone Marker:The Drosophila Gateway™ Vector Collection; Vector Backbone:pAHW; Vector Types:Insect Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23123195
Comments: This plasmid expresses a Renilla luciferase reporter for let-7 miRNA with a regular polyadenylation signal.

Proper citation: RRID:Addgene_50556 Copy   


  • RRID:Addgene_50561

http://www.addgene.org/50561

Species: Renilla, unknown
Genetic Insert: Luciferase-A114-N40
Vector Backbone Description: Backbone Marker:GeneScript; Backbone Size:2710; Vector Backbone:pUC57; Vector Types:cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22117217
Comments: Plasmid contains a defined A114 sequence followed by an EcoT22I site and a 40-bp arbitrary sequence downstream of Renilla lucferase. Unstable when transformed and so any retransformation must be checked by digest or sequencing before use. In strain MV1184, it is stable as a glycerol stock. Please note that the Rluc coding sequence contains an EcoT22I site. To prepare the T7 transcription template for A114 RNA (without N40), the plasmid should be first linearized by NdeI upstream of the T7 promoter sequence, followed by a partial digestion by EcoT22I. The DNA fragment terminating immediately downstream of the A114 sequence should then be gel purified. For A114-N40 RNA, the plasmid should be digested by HindIII downstream of the N40 sequence.

Proper citation: RRID:Addgene_50561 Copy   


  • RRID:Addgene_50603

http://www.addgene.org/50603

Genetic Insert: Limonene Synthase
Vector Backbone Description: Vector Backbone:E. coli DH10B; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23727191

Proper citation: RRID:Addgene_50603 Copy   


  • RRID:Addgene_50606

    This resource has 1+ mentions.

http://www.addgene.org/50606

Genetic Insert: tyrB
Vector Backbone Description: Vector Backbone:pRBS-01; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22020510

Proper citation: RRID:Addgene_50606 Copy   


  • RRID:Addgene_50608

http://www.addgene.org/50608

Vector Backbone Description: Backbone Marker:n/a; Backbone Size:7363; Vector Backbone:pTAL4; Vector Types:Yeast Expression, TALEN; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23124327
Comments: Addgene's quality control sequencing has found a few mismatches with the depositor's full sequence, but these discrepancies are not thought to affect plasmid function.

Proper citation: RRID:Addgene_50608 Copy   


  • RRID:Addgene_50572

http://www.addgene.org/50572

Species: Synthetic
Genetic Insert: DHFR-Ubiquitin-MetBetaGal-Ubiquitin-DHFR-Ubiquitin
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pRS426 Gal1; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11000112
Comments: There is a H to T mutation in front of the MetBetaGal. The mutation should not affect function.

Proper citation: RRID:Addgene_50572 Copy   


  • RRID:Addgene_50573

    This resource has 1+ mentions.

http://www.addgene.org/50573

Species: Mus musculus
Genetic Insert: UBR2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5427; Vector Backbone:pcDNA3.1(-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_50573 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X