Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Vector Backbone Description: Vector Backbone:pRS415; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38809589
Comments: The Linker-MYC-FAPoptim-MYC sequence was cloned into the SalI and XhoI sites of the pRS415-ADH1pr plasmid.
Proper citation: RRID:Addgene_221097 Copy
Species: Synthetic
Genetic Insert: sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Vector Backbone Description: Backbone Marker:Jamie Cate; Vector Backbone:pCAS (Addgene #60847); Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29626221
Proper citation: RRID:Addgene_160294 Copy
Vector Backbone Description: Vector Backbone:pRS413; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38809589
Comments: The Linker-MYC-FAPoptim-MYC sequence was cloned into the SalI and XhoI sites of the pRS413-ADH1pr plasmid.
Proper citation: RRID:Addgene_221099 Copy
Vector Backbone Description: Vector Backbone:pRS413; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38809589
Comments: The FAPoptim-MYC-Linker sequence was cloned into the BamHI and SmaI sites of the pRS413-ADH1pr plasmid.
Proper citation: RRID:Addgene_221098 Copy
Species: Synthetic
Genetic Insert: sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Vector Backbone Description: Backbone Marker:Jamie Cate; Vector Backbone:pCAS (Addgene #60847); Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29626221
Proper citation: RRID:Addgene_160296 Copy
Species: Synthetic
Genetic Insert: sgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
Vector Backbone Description: Backbone Marker:Jamie Cate; Vector Backbone:pCAS (Addgene #60847); Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29626221
Proper citation: RRID:Addgene_160299 Copy
Vector Backbone Description: Vector Backbone:pRS413; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38809589
Comments: The Linker-MYC-FAPoptim-MYC sequence was cloned into the SalI and XhoI sites of the pRS413-TEF1pr plasmid.
Proper citation: RRID:Addgene_221094 Copy
Species: Homo sapiens
Genetic Insert: VSIR
Vector Backbone Description: Backbone Size:4616; Vector Backbone:modified pXJ40; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38165805
Proper citation: RRID:Addgene_232663 Copy
Vector Backbone Description: Vector Backbone:pRS415; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38809589
Comments: The FAPorig-MYC-Linker sequence was cloned into the BamHI and SmaI sites of the pRS415-TEF1pr plasmid.
Proper citation: RRID:Addgene_221086 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: ERG6-FAPoptim
Vector Backbone Description: Vector Backbone:pRS413; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38809589
Comments: The coding sequence of ERG6 lacking the stop codon was PCR amplified with primers containing BamHI and SmaI restriction enzyme adaptors. The PCR product was then inserted into the pRS413-TEF1pr-NFAPoptim plasmid using standard cloning approaches.
Proper citation: RRID:Addgene_221121 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: pHluorin
Vector Backbone Description: Vector Backbone:pFA6-HPHMX4; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38809589
Comments: This pHluorin integration plasmid was constructed by subcloning the 977 bp SalI/BglII fragment from pBW1571 (pFA6a-pHluorin::KANMX6 from (Prosser et al., 2010) into the SalI/BglII sites of pAG32 (pFA6-HPHMX4 described in (Goldstein and McCusker, 1999). The resulting plasmid was used for C-terminal tagging of the endogenous STE3 locus using a PCR-based integration strategy described in (Longtine et al., 1998)
Proper citation: RRID:Addgene_221127 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: RPA34-FAPoptim
Vector Backbone Description: Vector Backbone:pRS413; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38809589
Comments: The coding sequence of RPA34 lacking the stop codon was PCR amplified with primers containing BamHI and SmaI restriction enzyme adaptors. The PCR product was then inserted into the pRS413-TEF1pr-NFAPoptim plasmid using standard cloning approaches.
Proper citation: RRID:Addgene_221123 Copy
Vector Backbone Description: Vector Backbone:pRS415; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38809589
Comments: The Linker-MYC-FAPoptim-MYC sequence was cloned into the SalI and XhoI sites of the pRS415-TEF1pr plasmid.
Proper citation: RRID:Addgene_221089 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: PMA1-FAPoptim
Vector Backbone Description: Vector Backbone:pRS413; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38809589
Comments: The coding sequence of PMA1 lacking the stop codon was PCR amplified with primers containing BamHI and SmaI restriction enzyme adaptors. The PCR product was then inserted into the pRS413-TEF1pr-NFAPoptim plasmid using standard cloning approaches.
Proper citation: RRID:Addgene_221122 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: VPH1-FAPoptim
Vector Backbone Description: Vector Backbone:pRS413; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38809589
Comments: The coding sequence of VPH1 lacking the stop codon was PCR amplified with primers containing BamHI and SmaI restriction enzyme adaptors. The PCR product was then inserted into the pRS413-TEF1pr-NFAPoptim plasmid using standard cloning approaches.
Proper citation: RRID:Addgene_221125 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: SEC7-FAPoptim
Vector Backbone Description: Vector Backbone:pRS413; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38809589
Comments: The coding sequence of SEC7 lacking the stop codon was PCR amplified with primers containing BamHI and SmaI restriction enzyme adaptors. The PCR product was then inserted into the pRS413-TEF1pr-NFAPoptim plasmid using standard cloning approaches.
Proper citation: RRID:Addgene_221124 Copy
Vector Backbone Description: Vector Backbone:pRS413; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38809589
Comments: The FAPorig-MYC-Linker sequence was cloned into the BamHI and SmaI sites of the pRS413-TEF1pr plasmid.
Proper citation: RRID:Addgene_221091 Copy
Vector Backbone Description: Vector Backbone:pRS415; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38809589
Comments: The FAPoptim-MYC-Linker sequence was cloned into the BamHI and SmaI sites of the pRS415-TEF1pr plasmid and the MFA1 signal sequence was cloned into the XbaI/SpeI sites upstream of the FAP tag to help target constructs to the ER.
Proper citation: RRID:Addgene_221090 Copy
Species: Homo sapiens
Genetic Insert: SP5
Vector Backbone Description: Backbone Size:4669; Vector Backbone:modified pXJ40; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38165805
Proper citation: RRID:Addgene_232653 Copy
Genetic Insert: EGFP
Vector Backbone Description: Vector Backbone:pAAV-CAG-FLuc (Addgene 83281); Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39676077
Proper citation: RRID:Addgene_219862 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
