Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Issues Status:no known issues (facet)

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

740,584 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
r. pT7-7-SNCA-5Asn
 
Resource Report
Resource Website 		RRID:Addgene_107295 SNCA-5Asn Homo sapiens Ampicillin PMID:28939194 Vector Backbone:pT7-7; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:01:08 0
s2. pT7-7-SNCA-5Asp
 
Resource Report
Resource Website 		RRID:Addgene_107293 SNCA-5Asp Homo sapiens Ampicillin PMID:28939194 Vector Backbone:pT7-7; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:01:08 0
pCSD_2XNLS-SpCas9MT2-NLS-3xHA-2XNLS-NmCas9WT-2XNLS
 
Resource Report
Resource Website 		RRID:Addgene_107326 SpCas9-NmCas9 fusion Synthetic Ampicillin PMID:30451839 Vector Backbone:pCSDest2; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin SpCas9 (R1333S) is fused to NmCas9 2026-08-15 01:01:09 0
pCSD_2XNLS-SpCas9MT3-NLS-3xHA-2XNLS-NmCas9WT-2XNLS
 
Resource Report
Resource Website 		RRID:Addgene_107325 SpCas9-NmCas9 fusion Synthetic Ampicillin PMID:30451839 Vector Backbone:pCSDest2; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin SpCas9 (R1335K) is fused to NmCas9 2026-08-15 01:01:09 0
pCSD_SpCas9MT3-NLS-3xHA-NLS-SaCas9WT-2xNLS
 
Resource Report
Resource Website 		RRID:Addgene_107322 SpCas9-SaCas9 fusion Synthetic Ampicillin PMID:30451839 Vector Backbone:pCSDest2; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin SpCas9 (R1335K) is fused to SaCas9 2026-08-15 01:01:09 0
TrubIFN-γ
 
Resource Report
Resource Website 		RRID:Addgene_107288 Interferon gamma Takifugu rubripes (fish) Kanamycin PMID:29742458 Backbone Marker:Novagen; Backbone Size:5360; Vector Backbone:pET26b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:01:08 0
OnilIFN-γ
 
Resource Report
Resource Website 		RRID:Addgene_107287 Interferon gamma Oreochromis niloticus (fish) Kanamycin PMID:29742458 Backbone Marker:Novagen; Backbone Size:5360; Vector Backbone:pET26b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:01:08 0
pMTgR2
 
Resource Report
Resource Website 		RRID:Addgene_107286 Interferon gamma receptor 2 Homo sapiens Ampicillin PMID:27599734 Crystal structure of the extracellular part of receptor 2 of human interferon gamma; PDB ID 5eh1; doi: 10.1107/S2059798316012237 Backbone Marker:Invitrogen; Backbone Size:3646; Vector Backbone:pMT-BiP-V5-His; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:01:09 0
pBluescript_VEGFA-TS3_SpCas9
 
Resource Report
Resource Website 		RRID:Addgene_107328 VEGFA-TS3 sgRNA Ampicillin PMID:30451839 Vector Backbone:pBluescript; Vector Types:CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:01:09 0
pAGH23
 
Resource Report
Resource Website 		RRID:Addgene_107262 curT Gentamicin PMID:29357135 this plasmid has also been used in: Heinz et al., Plant Cell 2016, DOI: https://doi.org/10.1105/tpc.16.00491 Backbone Size:4600; Vector Backbone:pBR322; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Gentamicin 2026-08-15 01:01:09 0
pAGH51
 
Resource Report
Resource Website 		RRID:Addgene_107255 HU-FRB Synthetic Kanamycin PMID:29357135 Backbone Size:4313; Vector Backbone:pBR322; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-15 01:01:08 0
RNA motif plasmid cloning backbone
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_107253 RNA motif plasmid cloning backbone Ampicillin PMID:29400715 Digest plasmid with BsmBI and ligate RNA motif of interest. The RNA motif of interest would be in the 3UTR and flanked by BoxB motifs. Oligo cloning can be performed similarly to sgRNA cloning. Primers to order: Primers (5'->3') F GCTT R AGCT Example to clone in motif IRE motif IRE motif: TAACACATTATCGGGAGCAGTGTCTTCCATAATGTATAA Primers to order F: GCTT TAACACATTATCGGGAGCAGTGTCTTCCATAATGTATAA R: AGCT TTATACATTATGGAAGACACTGCTCCCGATAATGTGTTA Vector Backbone:pLEX; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:01:08 5
CAG-Avr-HPRT-RIGHT
 
Resource Report
Resource Website 		RRID:Addgene_107272 HPRT1_B Avr-TALEN (right) Ampicillin PMID:29507284 Vector Backbone:ptCMV-136/63-VR; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Ampicillin 2026-08-15 01:01:09 0
CAG-Avr-HPRT-LEFT
 
Resource Report
Resource Website 		RRID:Addgene_107271 HPRT1_B Avr-TALEN (left) Ampicillin PMID:29507284 Vector Backbone:ptCMV-136/63-VR; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Ampicillin 2026-08-15 01:01:08 0
pUDP123
 
Resource Report
Resource Website 		RRID:Addgene_107269 polycistronic HH-gRNA-HDV-HH-gRNA-HDV array targetting OpADE2 and NIAD in O. parapolymorpha Ogataea parapolymorpha Ampicillin PMID:29438517 Backbone Marker:Juergens H et al. Genome editing in Kluyveromyces and Ogataea yeasts using a broad-host-range Cas9/gRNA expression plasmid; Backbone Size:10046; Vector Backbone:pUDP002 #103872; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:01:09 0
pSmartBAC-S
 
Resource Report
Resource Website 		RRID:Addgene_107268 Chloramphenicol PMID:29897754 Also carries apramycin resistance cassette. Selection for chloramphenicol and/or apramycin resistance will maintain the plasmid. Backbone Marker:Lucigen Corporation; Backbone Size:7648; Vector Backbone:pSmartBAC (EU101022.1); Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol 2026-08-15 01:01:08 0
mCherry-eDHFR-Cdc42Q61L
 
Resource Report
Resource Website 		RRID:Addgene_107267 mCherry-eDHFR-Cdc42Q61L Homo sapiens Ampicillin PMID:29097549 Backbone Marker:Carmen Williams (Addgene plasmid #32374); Vector Backbone:pIVT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:01:08 0
pRecLV105
 
Resource Report
Resource Website 		RRID:Addgene_107238 Ampicillin PMID:29431698 Please visit https://www.biorxiv.org/content/early/2017/02/09/107201 for bioRxiv preprint. Backbone Marker:GeneCopoeia; Vector Backbone:pRecLV105; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:01:08 0
pHJ1_Full length LexA
 
Resource Report
Resource Website 		RRID:Addgene_107237 Full length LexA repressor Synthetic Kanamycin PMID:28946740 Backbone Size:6363; Vector Backbone:pSB4K5; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-15 01:01:08 0
pLX304-MARK3_T211A
 
Resource Report
Resource Website 		RRID:Addgene_107236 MARK3 Ampicillin PMID:29431698 Please visit https://www.biorxiv.org/content/early/2017/02/09/107201 for bioRxiv preprint. Backbone Marker:Addgene; Vector Backbone:pLX304; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:01:09 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch