Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: EWSR1
Vector Backbone Description: Backbone Marker:Amersham; Backbone Size:4900; Vector Backbone:pGEX-6p-2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16044463
Comments: The EWS cDNA23 was PCR-amplified using primers
ATCTGGAATTCAAATGGCGTCCACGGATTACAGTACCTATAGCCAAGCTGCAGC and CTGGTAGTCAATGCAGCTCGAGGGGGTCTCTGCATCTAGTAGG.
Proper citation: RRID:Addgene_46384 Copy
Species: Homo sapiens
Genetic Insert: Crk
Vector Backbone Description: Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17588523
Comments: The molecular weight of the GST fusion protein is approximately 38.9 kDa
Proper citation: RRID:Addgene_46418 Copy
Species: Homo sapiens
Genetic Insert: chimerin
Vector Backbone Description: Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17588523
Comments: The molecular weight of the GST fusion protein is approximately 36.8 kDa
Proper citation: RRID:Addgene_46415 Copy
Species: Homo sapiens
Genetic Insert: chimerin2
Vector Backbone Description: Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17588523
Comments: The molecular weight of the GST fusion protein is approximately 37.1 kDa
Proper citation: RRID:Addgene_46416 Copy
Species: Homo sapiens
Genetic Insert: GAS5
Vector Backbone Description: Backbone Marker:promega; Backbone Size:4818; Vector Backbone:pGL3-Basic; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24885398
Comments: This promoter from a cancer line expressing high levels of GAS5 and contains two mismatches in the GAS5 region.
Proper citation: RRID:Addgene_46371 Copy
Species: Homo sapiens
Genetic Insert: Blnk
Vector Backbone Description: Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17588523
Comments: The molecular weight of the GST fusion protein is approximately 39.5 kDa
Proper citation: RRID:Addgene_46408 Copy
Species: Homo sapiens
Genetic Insert: Bks
Vector Backbone Description: Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17588523
Comments: The molecular weight of the GST fusion protein is approximately 39 kDa
Proper citation: RRID:Addgene_46406 Copy
Species: Homo sapiens
Genetic Insert: Blk
Vector Backbone Description: Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17588523
Comments: The molecular weight of the GST fusion protein is approximately 37.7 kDa
Proper citation: RRID:Addgene_46407 Copy
Species: E. coli
Genetic Insert: Streptavidin-Glutamate_Tag
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5400; Vector Backbone:pET21; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24056174
Proper citation: RRID:Addgene_46367 Copy
Vector Backbone Description: Vector Backbone:pUC/2 micrometer plasmid; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24058528
Proper citation: RRID:Addgene_46365 Copy
Species: Homo sapiens
Genetic Insert: Aps
Vector Backbone Description: Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17588523
Comments: The molecular weight of the GST fusion protein is approximately 39.1 kDa
Proper citation: RRID:Addgene_46404 Copy
Species: Homo sapiens
Genetic Insert: Arg/Abl2
Vector Backbone Description: Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17588523
Comments: The molecular weight of the GST fusion protein is approximately 37.2 kDa
Proper citation: RRID:Addgene_46405 Copy
Species: Mus musculus
Genetic Insert: Abl RK
Vector Backbone Description: Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX2T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17588523
Comments: The molecular weight of the GST fusion protein is approximately 36.6 kDa
Proper citation: RRID:Addgene_46403 Copy
Species: Homo sapiens
Genetic Insert: H2B
Vector Backbone Description: Vector Backbone:pBABE; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23870127
Proper citation: RRID:Addgene_46363 Copy
Species: Homo sapiens
Genetic Insert: EB1
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pBABE; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23870127
Proper citation: RRID:Addgene_46364 Copy
Species: Homo sapiens
Genetic Insert: PLCg1(NC)
Vector Backbone Description: Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17588523
Comments: The molecular weight of the GST fusion protein is approximately 48.2 kDa
Proper citation: RRID:Addgene_46471 Copy
Species: Homo sapiens
Genetic Insert: p85b(C)
Vector Backbone Description: Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17588523
Comments: The molecular weight of the GST fusion protein is approximately 39 kDa
Proper citation: RRID:Addgene_46466 Copy
Species: Homo sapiens
Genetic Insert: p85b(N)
Vector Backbone Description: Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17588523
Comments: The molecular weight of the GST fusion protein is approximately 38.5 kDa
Proper citation: RRID:Addgene_46467 Copy
Species: Homo sapiens
Genetic Insert: p85a(N)
Vector Backbone Description: Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17588523
Comments: The molecular weight of the GST fusion protein is approximately 38.5 kDa
Proper citation: RRID:Addgene_46464 Copy
Species: Bos taurus
Genetic Insert: p85b(NC)
Vector Backbone Description: Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17588523
Comments: The molecular weight of the GST fusion protein is approximately 67.1 kDa
Proper citation: RRID:Addgene_46468 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
