Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Bacterial Resistance:ampicillin (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

328,495 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pcDNA-Wnt4
 
Resource Report
Resource Website 		RRID:Addgene_35910 Wnt4 Homo sapiens Ampicillin PMID:22784633 Backbone Marker:Invitrogen; Backbone Size:7711; Vector Backbone:pcDNA3.2/V5-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Silent Mutation C (492) --> T 2026-08-15 01:14:07 0
pcDNA-Wnt7A
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_35914 Wnt7A Homo sapiens Ampicillin PMID:22784633 Backbone Marker:Invitrogen; Backbone Size:7711; Vector Backbone:pcDNA3.2/V5-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin None 2026-08-15 01:14:04 3
pcDNA-Wnt6
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_35913 Wnt6 Homo sapiens Ampicillin PMID:22784633 Backbone Marker:Invitrogen; Backbone Size:7711; Vector Backbone:pcDNA3.2/V5-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Silent Mutation G (567) --> A 2026-08-15 01:14:07 1
pcDNA-Wnt5B
 
Resource Report
Resource Website 		RRID:Addgene_35912 Wnt5B Homo sapiens Ampicillin PMID:22784633 Backbone Marker:Invitrogen; Backbone Size:7711; Vector Backbone:pcDNA3.2/V5-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin None 2026-08-15 01:14:04 0
pcDNA-Wnt9B
 
Resource Report
Resource Website 		RRID:Addgene_35919 Wnt9B Homo sapiens Ampicillin PMID:22784633 Backbone Marker:Invitrogen; Backbone Size:7711; Vector Backbone:pcDNA3.2/V5-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin SNP Met106-->Thr 2026-08-15 01:14:07 0
pcDNA-Wnt2B2
 
Resource Report
Resource Website 		RRID:Addgene_35907 Wnt2B2 Homo sapiens Ampicillin PMID:22784633 Backbone Marker:Invitrogen; Backbone Size:7711; Vector Backbone:pcDNA3.2/V5-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin None 2026-08-15 01:14:07 0
pcDNA-Wnt2
 
Resource Report
Resource Website 		RRID:Addgene_35906 Wnt2 Homo sapiens Ampicillin PMID:22784633 Backbone Marker:Invitrogen; Backbone Size:7711; Vector Backbone:pcDNA3.2/V5-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Silent Mutation G (816) --> A 2026-08-15 01:14:04 0
pMKO.1-Zfp423
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_35972 zfp423 shRNA Mus musculus Ampicillin PMID:20200519 Forward Oligo 5' CCGGCCCTGAATGTAACGTGAAGTTCTCGAGAACTTCACGTTACATTCAGGGTTTTTG 3' Reverse Oligo 5' AATTCAAAAACCCTGAATGTAACGTGAAGTTCTCGAGAACTTCACGTTACATTCAGGG 3' Backbone Size:6700; Vector Backbone:pMKO.1; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin 2026-08-15 01:14:04 2
MDH1-PGK-FLAG-TAT-86-A
 
Resource Report
Resource Website 		RRID:Addgene_35977 transactivating protein Human Immunodeficiency Virus Ampicillin PMID:25613133 Backbone Marker:Addgene Plasmid Repository; Backbone Size:6963; Vector Backbone:MDH1-PGK-GFP_2.0; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin From the "A" HIV clade 2026-08-15 01:14:08 0
pcDNA4-Myc-eIF3f
 
Resource Report
Resource Website 		RRID:Addgene_35975 eukaryotic translation initiation factor 3, subunit F Homo sapiens Ampicillin PMID:19237569 Please see the following article for additional information on the use of this plasmid: Valente et al., Mol Cell. 2009 Oct 23;36(2):279-89 https://www.ncbi.nlm.nih.gov/pubmed/19854136 Backbone Marker:Invitrogen; Backbone Size:5075; Vector Backbone:pcDNA4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:04 0
pcDNA3.1-hnRNPU-V5
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_35974 heterogeneous nuclear ribonucleoprotein U Homo sapiens Ampicillin PMID:25613133 Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:08 4
MDH1-PGK-FLAG-TAT-SIVmac251
 
Resource Report
Resource Website 		RRID:Addgene_35979 transactivating protein Simian Immunodeficiency Virus Ampicillin PMID:25613133 Backbone Marker:Addgene Plasmid Repository; Backbone Size:6963; Vector Backbone:MDH1-PGK-GFP_2.0; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin SIV strain mac251 2026-08-15 01:14:04 0
pLenti-MP2
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_36097 Ampicillin PMID:23792206 The backbone is described the Naldini group in Dull et al., 1998 (JVI) and was modified by Anthony Oliva and Jia Pingping at the Miami project. Backbone Marker:Naldini Lab; Backbone Size:6782; Vector Backbone:pRRLsinPPT-CMV-MCS-WPRE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:14:05 11
pRS424GFP-FYVE(EEA1)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_36096 FYVE(EEA1) domain Homo sapiens Ampicillin PMID:9702203 Vector Backbone:pRS424; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:08 4
pRS424GFP-2xPH(Osh2)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_36095 2xPH(Osh2) fusion Saccharomyces cerevisiae Ampicillin PMID:21295699 Please note that the first Osh2 domain contains aa273-421 and the second Osh2 domains contains aa260-421 when compared to GenBank reference sequence NP_010265.1. According to this reference sequence the PH domain is aa 292–384. The additional residues surrounding the PH domain were intentionally cloned into this construct. Vector Backbone:pRS424; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:05 2
pEBB-TB
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_36099 Ampicillin PMID:20671728 After mammal transfection, supplement fresh media with 4 uM Biotin to "charge" tag by Biotin. Allow cells to grow for about 48 h before the purification steps. Backbone Size:5450; Vector Backbone:pEBB; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:08 1
PcDNA-DEST47-CypB-Del1 C-term GFP
 
Resource Report
Resource Website 		RRID:Addgene_36132 cyclophilin B Homo sapiens Ampicillin PMID:22426501 Backbone Marker:Invitrogen; Backbone Size:7780; Vector Backbone:pcDNA-DEST47; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin contains amino acids 37-216 of cyclophilin B 2026-08-15 01:14:08 0
gabra5_L (TAL3014)
 
Resource Report
Resource Website 		RRID:Addgene_36006 TAL array targeting gabra5 Danio rerio Ampicillin PMID:21822241 Vector Backbone:JDS 74; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:04 0
Park2_R (TAL 3013)
 
Resource Report
Resource Website 		RRID:Addgene_36005 TAL array targeting Park2 Danio rerio Ampicillin PMID:21822241 Vector Backbone:JDS 71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:04 0
GDF2_R (TAL 3011)
 
Resource Report
Resource Website 		RRID:Addgene_36003 TAL array targeting GDF2 Danio rerio Ampicillin PMID:21822241 Vector Backbone:JDS 74; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:04 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch