Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:danio rerio (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

2,192 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pT2-cryR;sheCE1-P1Egfp
 
Resource Report
Resource Website 		RRID:Addgene_90150 sheE1P1Egfp Danio rerio Ampicillin PMID:28723572 Backbone Marker:Addgene; Vector Backbone:pDESTtol2pACrymCherry; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:22:04 0
pT2-cryR;snx5CE1-P1Egfp
 
Resource Report
Resource Website 		RRID:Addgene_90152 snx5E1P1Egfp Danio rerio Ampicillin PMID:28723572 Backbone Marker:Addgene; Vector Backbone:pDESTtol2pACrymCherry; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:22:04 0
pT2-cryR;dll4CE2-P1Egfp
 
Resource Report
Resource Website 		RRID:Addgene_90147 dll4E2P1Egfp Danio rerio Ampicillin PMID:28723572 Backbone Marker:Addgene; Vector Backbone:pDESTtol2pACrymCherry; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:22:04 0
pT2-cryR;nrp1bCE1-P1Egfp
 
Resource Report
Resource Website 		RRID:Addgene_90149 nrp1bE1P1Egfp Danio rerio Ampicillin PMID:28723572 Backbone Marker:Addgene; Vector Backbone:pDESTtol2pACrymCherry; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:22:04 0
pT2-cryR;tmem88aCE1-P1Egfp
 
Resource Report
Resource Website 		RRID:Addgene_90148 tmem88aE1P1Egfp Danio rerio Ampicillin PMID:28723572 Backbone Marker:Addgene; Vector Backbone:pDESTtol2pACrymCherry; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:22:04 0
pRCIscript-crhr1_TAL1A
 
Resource Report
Resource Website 		RRID:Addgene_44234 crhr1 pTAL scaffold 1A Danio rerio Ampicillin PMID:23000899 Please note that some of the NN RVDs of this TALEN plasmid, which recognize G nucleotides were actually made with NK RVDs (which also recognize G nucleotides). This alters a single amino acid within the RVD Backbone Marker:Addgene plasmid 38142; Backbone Size:4651; Vector Backbone:RCIscript-GoldyTALEN; Vector Types:mRNA transcription vector; Bacterial Resistance:Ampicillin 2026-08-15 01:15:13 0
pRCIscript-crhr2_TAL1A
 
Resource Report
Resource Website 		RRID:Addgene_44236 crhr2 pTAL scaffold 1A Danio rerio Ampicillin PMID:23000899 Please note that some of the NN RVDs of this TALEN plasmid, which recognize G nucleotides were actually made with NK RVDs (which also recognize G nucleotides). This alters a single amino acid within the RVD. Backbone Marker:Addgene plasmid 38142; Backbone Size:4651; Vector Backbone:RCIscript-GoldyTALEN; Vector Types:mRNA transcription vector; Bacterial Resistance:Ampicillin 2026-08-15 01:15:13 0
pRCIscript-crhr1_TAL1B
 
Resource Report
Resource Website 		RRID:Addgene_44235 crhr1 pTAL scaffold 1B Danio rerio Ampicillin PMID:23000899 Please note that some of the NN RVDs of this TALEN plasmid, which recognize G nucleotides were actually made with NK RVDs (which also recognize G nucleotides). This alters a single amino acid within the RVD. Backbone Marker:Addgene plasmid 38142; Backbone Size:4651; Vector Backbone:RCIscript-GoldyTALEN; Vector Types:mRNA transcription vector; Bacterial Resistance:Ampicillin 2026-08-15 01:15:14 0
pJMD-In3.4:EGFP
 
Resource Report
Resource Website 		RRID:Addgene_44662 Angptl4 Intronic Region 3.4 Danio rerio Ampicillin Backbone Size:5883; Vector Backbone:pDestTol2pA2; Vector Types:Tol2 vector; Bacterial Resistance:Ampicillin 2026-08-15 01:15:18 0
fj89c07 #2 in pBK-CMV
 
Resource Report
Resource Website 		RRID:Addgene_44966 Angptl4 Danio rerio Kanamycin Note from the depositor: This plasmid is an EST containing a fragment of the zebrafish angptl4 gene. There are multiple SNPs in the gene that vary between zebrafish strains. This is intended for use in riboprobe synthesis, not for cloning. Vector Backbone:pBK-CMV; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:15:20 0
p5E-1.7kbfabp6
 
Resource Report
Resource Website 		RRID:Addgene_159087 1.7kb fabp6 promoter Danio rerio Kanamycin PMID:34301599 Backbone Marker:tol2kit; Vector Backbone:p5E-Fse-Asc entry vector; Vector Types:promoter fragment 5' entry vector for tol2 cloning; Bacterial Resistance:Kanamycin 2026-08-15 01:23:50 0
pDONR221-si:ch73-1a9.3
 
Resource Report
Resource Website 		RRID:Addgene_192717 si:ch73-1a9.3 Danio rerio Kanamycin cDNA encodes NP_001373649.1; homolog of human HMGN1 Backbone Marker:Invitrogen; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 2026-08-15 01:24:19 0
pDONR221-si:ch73-281n10.2
 
Resource Report
Resource Website 		RRID:Addgene_192716 si:ch73-281n10.2 Danio rerio Kanamycin cDNA encodes NP_001296573.1; homolog of human HMGN1 Backbone Marker:Invitrogen; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 2026-08-15 01:24:19 0
pDONR221-ets2
 
Resource Report
Resource Website 		RRID:Addgene_192724 ets2 Danio rerio Kanamycin cDNA encodes NP_001018874.1; homolog of human ETS2 Backbone Marker:Invitrogen; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin N189D (rs502796915); S231N 2026-08-15 01:24:20 0
pDONR221-get1
 
Resource Report
Resource Website 		RRID:Addgene_192722 get1 Danio rerio Kanamycin cDNA encodes NP_001003413.1; homolog of human GET1 Backbone Marker:Invitrogen; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 2026-08-15 01:24:20 0
pDONR221-kcnj6
 
Resource Report
Resource Website 		RRID:Addgene_192725 kcnj6 Danio rerio Kanamycin cDNA encodes homolog of human KCNJ6 Backbone Marker:Invitrogen; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 5' insertion of ATGGCCAAGCTGACAGAATCC, identical to human KCNJ6 2026-08-15 01:24:20 0
pDONR221-appa
 
Resource Report
Resource Website 		RRID:Addgene_192745 appa Danio rerio Kanamycin cDNA encodes AFN73054.1; homolog of human APP Backbone Marker:Invitrogen; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin S47N 2026-08-15 01:24:21 0
pTwist-ENTR-rbm11-202
 
Resource Report
Resource Website 		RRID:Addgene_192729 rbm11 Danio rerio Kanamycin cDNA encodes rbm11-202; homolog of human RBM11 Backbone Marker:Twist Bioscience; Vector Backbone:pTwist ENTR Kozak; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 2026-08-15 01:24:21 0
pDONR221-nrip1a
 
Resource Report
Resource Website 		RRID:Addgene_192731 nrip1a Danio rerio Kanamycin cDNA encodes XP_005157806.1; homolog of human NRIP1 Backbone Marker:Invitrogen; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin E662Q; S895P; H967Q 2026-08-15 01:24:21 0
pDONR221-btg3
 
Resource Report
Resource Website 		RRID:Addgene_192735 btg3 Danio rerio Kanamycin cDNA encodes NP_001313635.1; homolog of human BTG3 Backbone Marker:Invitrogen; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin H211Y 2026-08-15 01:24:21 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch