Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pT2-cryR;sheCE1-P1Egfp Resource Report Resource Website |
RRID:Addgene_90150 | sheE1P1Egfp | Danio rerio | Ampicillin | PMID:28723572 | Backbone Marker:Addgene; Vector Backbone:pDESTtol2pACrymCherry; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:22:04 | 0 | ||
|
pT2-cryR;snx5CE1-P1Egfp Resource Report Resource Website |
RRID:Addgene_90152 | snx5E1P1Egfp | Danio rerio | Ampicillin | PMID:28723572 | Backbone Marker:Addgene; Vector Backbone:pDESTtol2pACrymCherry; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:22:04 | 0 | ||
|
pT2-cryR;dll4CE2-P1Egfp Resource Report Resource Website |
RRID:Addgene_90147 | dll4E2P1Egfp | Danio rerio | Ampicillin | PMID:28723572 | Backbone Marker:Addgene; Vector Backbone:pDESTtol2pACrymCherry; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:22:04 | 0 | ||
|
pT2-cryR;nrp1bCE1-P1Egfp Resource Report Resource Website |
RRID:Addgene_90149 | nrp1bE1P1Egfp | Danio rerio | Ampicillin | PMID:28723572 | Backbone Marker:Addgene; Vector Backbone:pDESTtol2pACrymCherry; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:22:04 | 0 | ||
|
pT2-cryR;tmem88aCE1-P1Egfp Resource Report Resource Website |
RRID:Addgene_90148 | tmem88aE1P1Egfp | Danio rerio | Ampicillin | PMID:28723572 | Backbone Marker:Addgene; Vector Backbone:pDESTtol2pACrymCherry; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:22:04 | 0 | ||
|
pRCIscript-crhr1_TAL1A Resource Report Resource Website |
RRID:Addgene_44234 | crhr1 pTAL scaffold 1A | Danio rerio | Ampicillin | PMID:23000899 | Please note that some of the NN RVDs of this TALEN plasmid, which recognize G nucleotides were actually made with NK RVDs (which also recognize G nucleotides). This alters a single amino acid within the RVD | Backbone Marker:Addgene plasmid 38142; Backbone Size:4651; Vector Backbone:RCIscript-GoldyTALEN; Vector Types:mRNA transcription vector; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:13 | 0 | |
|
pRCIscript-crhr2_TAL1A Resource Report Resource Website |
RRID:Addgene_44236 | crhr2 pTAL scaffold 1A | Danio rerio | Ampicillin | PMID:23000899 | Please note that some of the NN RVDs of this TALEN plasmid, which recognize G nucleotides were actually made with NK RVDs (which also recognize G nucleotides). This alters a single amino acid within the RVD. | Backbone Marker:Addgene plasmid 38142; Backbone Size:4651; Vector Backbone:RCIscript-GoldyTALEN; Vector Types:mRNA transcription vector; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:13 | 0 | |
|
pRCIscript-crhr1_TAL1B Resource Report Resource Website |
RRID:Addgene_44235 | crhr1 pTAL scaffold 1B | Danio rerio | Ampicillin | PMID:23000899 | Please note that some of the NN RVDs of this TALEN plasmid, which recognize G nucleotides were actually made with NK RVDs (which also recognize G nucleotides). This alters a single amino acid within the RVD. | Backbone Marker:Addgene plasmid 38142; Backbone Size:4651; Vector Backbone:RCIscript-GoldyTALEN; Vector Types:mRNA transcription vector; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:14 | 0 | |
|
pJMD-In3.4:EGFP Resource Report Resource Website |
RRID:Addgene_44662 | Angptl4 Intronic Region 3.4 | Danio rerio | Ampicillin | Backbone Size:5883; Vector Backbone:pDestTol2pA2; Vector Types:Tol2 vector; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:18 | 0 | |||
|
fj89c07 #2 in pBK-CMV Resource Report Resource Website |
RRID:Addgene_44966 | Angptl4 | Danio rerio | Kanamycin | Note from the depositor: This plasmid is an EST containing a fragment of the zebrafish angptl4 gene. There are multiple SNPs in the gene that vary between zebrafish strains. This is intended for use in riboprobe synthesis, not for cloning. | Vector Backbone:pBK-CMV; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:20 | 0 | ||
|
p5E-1.7kbfabp6 Resource Report Resource Website |
RRID:Addgene_159087 | 1.7kb fabp6 promoter | Danio rerio | Kanamycin | PMID:34301599 | Backbone Marker:tol2kit; Vector Backbone:p5E-Fse-Asc entry vector; Vector Types:promoter fragment 5' entry vector for tol2 cloning; Bacterial Resistance:Kanamycin | 2026-08-15 01:23:50 | 0 | ||
|
pDONR221-si:ch73-1a9.3 Resource Report Resource Website |
RRID:Addgene_192717 | si:ch73-1a9.3 | Danio rerio | Kanamycin | cDNA encodes NP_001373649.1; homolog of human HMGN1 | Backbone Marker:Invitrogen; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-15 01:24:19 | 0 | ||
|
pDONR221-si:ch73-281n10.2 Resource Report Resource Website |
RRID:Addgene_192716 | si:ch73-281n10.2 | Danio rerio | Kanamycin | cDNA encodes NP_001296573.1; homolog of human HMGN1 | Backbone Marker:Invitrogen; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-15 01:24:19 | 0 | ||
|
pDONR221-ets2 Resource Report Resource Website |
RRID:Addgene_192724 | ets2 | Danio rerio | Kanamycin | cDNA encodes NP_001018874.1; homolog of human ETS2 | Backbone Marker:Invitrogen; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | N189D (rs502796915); S231N | 2026-08-15 01:24:20 | 0 | |
|
pDONR221-get1 Resource Report Resource Website |
RRID:Addgene_192722 | get1 | Danio rerio | Kanamycin | cDNA encodes NP_001003413.1; homolog of human GET1 | Backbone Marker:Invitrogen; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-15 01:24:20 | 0 | ||
|
pDONR221-kcnj6 Resource Report Resource Website |
RRID:Addgene_192725 | kcnj6 | Danio rerio | Kanamycin | cDNA encodes homolog of human KCNJ6 | Backbone Marker:Invitrogen; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | 5' insertion of ATGGCCAAGCTGACAGAATCC, identical to human KCNJ6 | 2026-08-15 01:24:20 | 0 | |
|
pDONR221-appa Resource Report Resource Website |
RRID:Addgene_192745 | appa | Danio rerio | Kanamycin | cDNA encodes AFN73054.1; homolog of human APP | Backbone Marker:Invitrogen; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | S47N | 2026-08-15 01:24:21 | 0 | |
|
pTwist-ENTR-rbm11-202 Resource Report Resource Website |
RRID:Addgene_192729 | rbm11 | Danio rerio | Kanamycin | cDNA encodes rbm11-202; homolog of human RBM11 | Backbone Marker:Twist Bioscience; Vector Backbone:pTwist ENTR Kozak; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-15 01:24:21 | 0 | ||
|
pDONR221-nrip1a Resource Report Resource Website |
RRID:Addgene_192731 | nrip1a | Danio rerio | Kanamycin | cDNA encodes XP_005157806.1; homolog of human NRIP1 | Backbone Marker:Invitrogen; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | E662Q; S895P; H967Q | 2026-08-15 01:24:21 | 0 | |
|
pDONR221-btg3 Resource Report Resource Website |
RRID:Addgene_192735 | btg3 | Danio rerio | Kanamycin | cDNA encodes NP_001313635.1; homolog of human BTG3 | Backbone Marker:Invitrogen; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | H211Y | 2026-08-15 01:24:21 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.