Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Mentions:yes (facet)

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

32,424 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
CRISPRi non-coding library (CRiNCL) - Unique to iPSC
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_86540 Ampicillin PMID:27980086 Vector Backbone:pCRISPRia-v2; Vector Types:; Bacterial Resistance:Ampicillin 2026-08-15 01:21:35 1
CRISPRi non-coding library (CRiNCL) - Unique to HEK293T
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_86543 Ampicillin PMID:27980086 Vector Backbone:pCRISPRia-v2; Vector Types:; Bacterial Resistance:Ampicillin 2026-08-15 01:21:35 2
CRISPRi non-coding library (CRiNCL) - Unique to K562
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_86544 Ampicillin PMID:27980086 Vector Backbone:pCRISPRia-v2; Vector Types:; Bacterial Resistance:Ampicillin 2026-08-15 01:21:35 2
CRISPRi non-coding library (CRiNCL) - Unique to HFF
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_86541 Ampicillin PMID:27980086 Vector Backbone:pCRISPRia-v2; Vector Types:; Bacterial Resistance:Ampicillin 2026-08-15 01:21:35 2
pSJ1726 (pFA6-NATMX-CDC42pr-KAR2SS-GFP1-10)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_86421 CDC42pr-KAR2SS-GFP1-10 Saccharomyces cerevisiae Ampicillin PMID:27831485 Backbone Size:4000; Vector Backbone:pFA6-NATMX; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:21:34 1
MBP-TEV-VMA Model vector
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_86590 VMA intein Saccharomyces cerevisiae Ampicillin PMID:28186733 TGTCCTACTCAGGAGAGCGTTCAC to sequence VMA C-term; and ACCCATGACCTTATTACCAACCTC to sequence the insert between MBP C-term and VMA Vector Backbone:pMAL-c5X; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin Original SapI site from pMal was mutated out 2026-08-15 01:21:35 1
beta4-nAChR (DPM negative control)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_86651 CHRNB4 (control) Homo sapiens Ampicillin PMID:19896492 Vector Backbone:pSuper; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin 2026-08-15 01:21:36 1
AAV9:cTNT::3Flag-hYAP S127A
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_86558 YAP Homo sapiens Ampicillin PMID:24833660 After plasmid preparation, a SmaI diagnose digestion is necessary to confirm if there any mutation in the ITR regions. Backbone Marker:Upen vector core ; Vector Backbone:pAAV.cTNT.; Vector Types:AAV; Bacterial Resistance:Ampicillin Serine 127 was mutated into Alanine, to activate YAP. 2026-08-15 01:21:35 3
pTRIP-CMV-GFP-FLAG-cGAS
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_86675 GFP-FLAG-cGAS Ampicillin PMID:27013426 Vector Backbone:pTRIP; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:21:36 12
CANE-LV envelope
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_86666 CANE-LV envelope Synthetic Ampicillin PMID:27974160 Backbone Size:4821; Vector Backbone:pCASGS/ES; Vector Types:Mammalian Expression, Mouse Targeting, Lentiviral, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-15 01:21:36 4
eSpCas9(1.1)_No_FLAG_ATP1A1_G3_Dual_sgRNA
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_86613 ATP1A1 G3 sgRNA + user-specified sgRNA + FLAGless enhanced specificity Cas9 (1.1) S. pyogenes Ampicillin PMID:28417998 ATP1A1 G3 gRNA target sequence is GAGTTCTGTAATTCAGCATA Vector Backbone:pX330-U6-Chimeric_BB-CBh-hSpCas9; Vector Types:Mammalian Expression, CRISPR, Co-selection via HDR using ouabain; Bacterial Resistance:Ampicillin K848A, K1003A, & R1060A 2026-08-15 01:21:36 10
SELENOM CXXC
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_86579 SELENOM Homo sapiens Ampicillin PMID:28186733 Vector Backbone:pMAL-c5X; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin Sigal peptide was deleted; CXXC 2026-08-15 01:21:35 1
eSpCas9(1.1)_No_FLAG_ATP1A1_G2_Dual_sgRNA
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_86612 ATP1A1 G2 sgRNA + user-specified sgRNA + FLAGless enhanced specificity Cas9 (1.1) S. pyogenes Ampicillin PMID:28417998 ATP1A1 G2 gRNA target sequence is gatccaagctgctacagaag. Vector Backbone:pX330-U6-Chimeric_BB-CBh-hSpCas9; Vector Types:Mammalian Expression, CRISPR, Co-selection via NHEJ using ouabain; Bacterial Resistance:Ampicillin K848A, K1003A, & R1060A 2026-08-15 01:21:36 4
RSV-Flag-Brd4
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_86616 Brd4 Mus musculus Ampicillin PMID:22595521 Backbone Marker:PMID: 12490204; Backbone Size:4260; Vector Backbone:pAdRSV-Sp-Flag; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:21:36 1
pFBD-Akt1(E17K)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_86563 Akt1 Homo sapiens Ampicillin PMID:28157504 Cloned by Iva LUCIC Vector Backbone:pFastBac Dual; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin E17K mutation in the PH domain 2026-08-15 01:21:35 1
myc-Atg14
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_86747 human Atg14 Homo sapiens Ampicillin PMID:27046250 IMAGE: 40034574 Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:21:37 2
pEGFP×2-N1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_86775 Kanamycin PMID:27633000 Backbone Marker:Clontech; Backbone Size:5438; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:21:37 1
pBN42
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_86713 Pmyo-3::GFP Caenorhabditis elegans Ampicillin PMID:25653391 Vector Backbone:pPD49.83; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:21:37 1
pTRIP-SFFV-EGFP-NLS
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_86677 EGFP-NLS Ampicillin PMID:27013426 Vector Backbone:pTRIP; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:21:36 16
pBN41
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_86716 Pmyo-2::GFP Caenorhabditis elegans Ampicillin PMID:25653391 Vector Backbone:pPD49.83; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:21:37 2

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch