Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
On page 364 showing 7261 ~ 7280 out of 12,972 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

    • RRID:Addgene_183431

http://www.addgene.org/183431

Species: Mus musculus
Genetic Insert: gRNA
Vector Backbone Description: Vector Backbone:pOC2; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35851300
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.01.02.474730v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_183431 Copy   

http://www.addgene.org/181976

Species: Mus musculus
Genetic Insert: GATA1 gRNA: CCTAGACCAGGAAAATCCAT
Vector Backbone Description: Vector Backbone:pLeGO.iG2 ; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36493345

Proper citation: RRID:Addgene_181976 Copy   

    • RRID:Addgene_182642

http://www.addgene.org/182642

Species: Mus musculus
Genetic Insert: CDMPR
Vector Backbone Description: Backbone Marker:Clontech/Takara Bio; Backbone Size:7181; Vector Backbone:pQCXIP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35314489

Proper citation: RRID:Addgene_182642 Copy   

    • RRID:Addgene_183443

    This resource has 1+ mentions.

http://www.addgene.org/183443

Species: Mus musculus
Genetic Insert: gRNA and 2xGFP donor
Vector Backbone Description: Vector Backbone:pORANGE; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35851300
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.01.02.474730v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_183443 Copy   

http://www.addgene.org/83251

Species: Mus musculus
Genetic Insert: Stat5a
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pAD/CMV/V5-DEST; Vector Types:Adenoviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27131881

Proper citation: RRID:Addgene_83251 Copy   

http://www.addgene.org/129411

Species: Mus musculus
Genetic Insert: sgRNA targeting Slc1a3
Vector Backbone Description: Vector Backbone:pX335; Vector Types:Mammalian Expression, Mouse Targeting, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33686166

Proper citation: RRID:Addgene_129411 Copy   

http://www.addgene.org/183385

Species: Mus musculus
Genetic Insert: Caspase-1 (AA130-404)
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34734155

Proper citation: RRID:Addgene_183385 Copy   

http://www.addgene.org/183398

Species: Mus musculus
Genetic Insert: CARD domain of mouse caspase-11 fused to catalytic domain of canine caspase-1/4
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pMSCV-IRES-EGFP; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34734155

Proper citation: RRID:Addgene_183398 Copy   

http://www.addgene.org/183396

Species: Mus musculus
Genetic Insert: CARD domains of canine caspase-1/4 fused to catalytic domain of mouse caspase-11
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pMSCV-IRES-EGFP; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34734155

Proper citation: RRID:Addgene_183396 Copy   

    • RRID:Addgene_173581

http://www.addgene.org/173581

Species: Mus musculus
Genetic Insert: gRNA targeting Bap1
Vector Backbone Description: Vector Backbone:pLL3.3; Vector Types:Lentiviral, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33608386

Proper citation: RRID:Addgene_173581 Copy   

    • RRID:Addgene_173578

http://www.addgene.org/173578

Species: Mus musculus
Genetic Insert: gRNA targeting Atf7ip
Vector Backbone Description: Vector Backbone:pLL3.3; Vector Types:Lentiviral, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33608386

Proper citation: RRID:Addgene_173578 Copy   

    • RRID:Addgene_183389

    This resource has 1+ mentions.

http://www.addgene.org/183389

Species: Mus musculus
Genetic Insert: pro-IL18
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34734155

Proper citation: RRID:Addgene_183389 Copy   

http://www.addgene.org/183714

Species: Mus musculus
Genetic Insert: tdTomato with fragment (nucleotides 398-818) of mouse Actb coding dsequence
Vector Backbone Description: Backbone Size:7838; Vector Backbone:pHAGE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37249209
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.11.28.470233v2 for bioRxiv preprint.

Proper citation: RRID:Addgene_183714 Copy   

http://www.addgene.org/183716

Species: Mus musculus
Genetic Insert: tdTomato with fragment (nucleotides 1-440) of mouse Actb 3'UTR
Vector Backbone Description: Backbone Size:7838; Vector Backbone:pHAGE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37249209
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.11.28.470233v2 for bioRxiv preprint.

Proper citation: RRID:Addgene_183716 Copy   

    • RRID:Addgene_183462

    This resource has 1+ mentions.

http://www.addgene.org/183462

Species: Mus musculus
Genetic Insert: Alb
Vector Backbone Description: Backbone Marker:VVF (p438) https://vvf.ethz.ch/; Vector Backbone:pAAV-P3; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36313804
Comments: Please visit for https://www.biorxiv.org/content/10.1101/2022.04.08.487498v1 bioRxiv preprint. Please see Resource Information section for Tips for Alb Probes Injection.

Proper citation: RRID:Addgene_183462 Copy   

    • RRID:Addgene_183460

    This resource has 1+ mentions.

http://www.addgene.org/183460

Species: Mus musculus
Genetic Insert: Alb
Vector Backbone Description: Backbone Marker:VVF (p438) https://vvf.ethz.ch/; Vector Backbone:pAAV-P3; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36313804
Comments: Please visit for https://www.biorxiv.org/content/10.1101/2022.04.08.487498v1 bioRxiv preprint. Please see Resource Information section for Tips for Alb Probes Injection.

Proper citation: RRID:Addgene_183460 Copy   

    • RRID:Addgene_183461

    This resource has 1+ mentions.

http://www.addgene.org/183461

Species: Mus musculus
Genetic Insert: Alb
Vector Backbone Description: Backbone Marker:VVF (p438) https://vvf.ethz.ch/; Vector Backbone:pAAV-P3; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36313804
Comments: Please visit for https://www.biorxiv.org/content/10.1101/2022.04.08.487498v1 bioRxiv preprint. Please see Resource Information section for Tips for Alb Probes Injection.

Proper citation: RRID:Addgene_183461 Copy   

    • RRID:Addgene_173580

http://www.addgene.org/173580

Species: Mus musculus
Genetic Insert: gRNA targeting Atm
Vector Backbone Description: Vector Backbone:pLL3.3; Vector Types:Lentiviral, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33608386

Proper citation: RRID:Addgene_173580 Copy   

http://www.addgene.org/177537

Species: Mus musculus
Genetic Insert: anti-Kv3.3 K+ channel (Mus musculus) recombinant mouse monoclonal antibody
Vector Backbone Description: Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30667360
Comments: This is a recombinant antibody derived from RRID: AB_2877406. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute.

Proper citation: RRID:Addgene_177537 Copy   

http://www.addgene.org/184463

Species: Mus musculus
Genetic Insert: N-Flag-mSTAT5bCA
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35396838

Proper citation: RRID:Addgene_184463 Copy   

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch