Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 365 showing 7281 ~ 7300 out of 328,858 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/50921

Species: Homo sapiens
Genetic Insert: Oct4A -12 sgRNA
Vector Backbone Description: Backbone Size:7145; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24346702
Comments: gRNA target sequence GTGGGACTGGGGAGGGAGAG

Proper citation: RRID:Addgene_50921 Copy   


http://www.addgene.org/50923

Species: Homo sapiens
Genetic Insert: Sox17 -91 sgRNA
Vector Backbone Description: Backbone Size:7145; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24346702
Comments: gRNA target sequence GGGCGTGGGCCTAACGACGC

Proper citation: RRID:Addgene_50923 Copy   


http://www.addgene.org/50922

Species: Homo sapiens
Genetic Insert: Oct4A -158 sgRNA
Vector Backbone Description: Backbone Size:7145; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24346702
Comments: gRNA target sequence GGGGCGCCAGTTGTGTCTCC

Proper citation: RRID:Addgene_50922 Copy   


http://www.addgene.org/50884

Species: Homo sapiens
Genetic Insert: human NKCC1 (synthetic)
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA 3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24451383
Comments: Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct.

Proper citation: RRID:Addgene_50884 Copy   


  • RRID:Addgene_50929

http://www.addgene.org/50929

Vector Backbone Description: Backbone Marker:Nakagawa,T.; Backbone Size:6034; Vector Backbone:pUGW11; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23956122
Comments: Please use the reference links above to access a published protocol for using plasmids pRGE31, pRGEB31, pRGE32 and pRGEB32 as well as a CRISPR design software tool.

Proper citation: RRID:Addgene_50929 Copy   


http://www.addgene.org/50925

Species: Homo sapiens
Genetic Insert: Sox17 -177 sgRNA
Vector Backbone Description: Backbone Size:7145; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24346702
Comments: gRNA target sequence GCTCCGGCTAGTTTTCCCGG

Proper citation: RRID:Addgene_50925 Copy   


  • RRID:Addgene_50927

    This resource has 1+ mentions.

http://www.addgene.org/50927

Species: synthetic
Genetic Insert: negative control sgRNA
Vector Backbone Description: Backbone Size:7145; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24346702
Comments: Please note that Addgene's diagnostic digest results suggest that the backbone may be longer than suggested.

Proper citation: RRID:Addgene_50927 Copy   


http://www.addgene.org/50926

Species: Homo sapiens
Genetic Insert: Sox17-296 sgRNA
Vector Backbone Description: Backbone Size:7145; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24346702
Comments: gRNA target sequence GGGCAAGTACGTCGATTCCA

Proper citation: RRID:Addgene_50926 Copy   


http://www.addgene.org/50893

Species: Homo sapiens
Genetic Insert: human NKCC1 (synthetic)
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA 3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct.

Proper citation: RRID:Addgene_50893 Copy   


http://www.addgene.org/50899

Species: Homo sapiens
Genetic Insert: human NKCC1 (synthetic)
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA 3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct.

Proper citation: RRID:Addgene_50899 Copy   


  • RRID:Addgene_50932

http://www.addgene.org/50932

Species: Homo sapiens
Genetic Insert: SRP14 and SRP9
Vector Backbone Description: Backbone Marker:Chang-Deng Hu (Addgene Plasmid# 22010); Backbone Size:5216; Vector Backbone:pBiFC-VN173; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_50932 Copy   


  • RRID:Addgene_50934

http://www.addgene.org/50934

Species: Homo sapiens
Genetic Insert: scAluYNF1
Vector Backbone Description: Backbone Marker:Dewannieux,M., Esnault,C. and Heidmann,T. (2003) LINE-mediated retrotransposition of marked Alu sequences. Nat. Genet., 35, 41-4; Backbone Size:2773; Vector Backbone:pAlu-NeoTet; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25697503

Proper citation: RRID:Addgene_50934 Copy   


  • RRID:Addgene_50933

http://www.addgene.org/50933

Species: Homo sapiens
Genetic Insert: AluYNF1
Vector Backbone Description: Backbone Marker:Dewannieux,M., Esnault,C. and Heidmann,T. (2003) LINE-mediated retrotransposition of marked Alu sequences. Nat. Genet., 35, 41-4; Backbone Size:2773; Vector Backbone:pAlu-NeoTet; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25697503

Proper citation: RRID:Addgene_50933 Copy   


http://www.addgene.org/50894

Species: Homo sapiens
Genetic Insert: human NKCC1 (synthetic)
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA 3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct.

Proper citation: RRID:Addgene_50894 Copy   


http://www.addgene.org/50897

Species: Homo sapiens
Genetic Insert: human NKCC1 (synthetic)
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA 3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct.

Proper citation: RRID:Addgene_50897 Copy   


  • RRID:Addgene_50930

    This resource has 1+ mentions.

http://www.addgene.org/50930

Species: Homo sapiens
Genetic Insert: SRP14 and SRP9
Vector Backbone Description: Backbone Marker:Chang-Deng Hu (Addgene Plasmid# 22010); Backbone Size:5216; Vector Backbone:pBiFC-VN173; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_50930 Copy   


http://www.addgene.org/50896

Species: Homo sapiens
Genetic Insert: human NKCC1 (synthetic)
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA 3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct.

Proper citation: RRID:Addgene_50896 Copy   


  • RRID:Addgene_50939

    This resource has 1+ mentions.

http://www.addgene.org/50939

Species: Homo sapiens
Genetic Insert: PML-3
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4076; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10779416

Proper citation: RRID:Addgene_50939 Copy   


  • RRID:Addgene_50936

    This resource has 1+ mentions.

http://www.addgene.org/50936

Species: Homo sapiens
Genetic Insert: PTEN 3'UTR
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:6273; Vector Backbone:psiCheck-2; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22000013
Comments: Primers used to amplify the 3'UTR of PTEN: PTEN3′UTR-F TAGAGGAGCCGTCAAATCCA, PTEN3′UTR-R CCCCCACTTTAGTGCACAGT,

Proper citation: RRID:Addgene_50936 Copy   


  • RRID:Addgene_50941

    This resource has 1+ mentions.

http://www.addgene.org/50941

Species: Homo sapiens
Genetic Insert: RanGTPase activating protein 1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5677; Vector Backbone:pET11a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22464730

Proper citation: RRID:Addgene_50941 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X