Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: NRAS
Vector Backbone Description: Backbone Size:2693; Vector Backbone:pDonor-255; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin
Proper citation: RRID:Addgene_83176 Copy
Species: Homo sapiens
Genetic Insert: NRAS
Vector Backbone Description: Backbone Size:2693; Vector Backbone:pDonor-255; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin
Proper citation: RRID:Addgene_83178 Copy
Genetic Insert: 3XMyc-EGFP-OMP25
Vector Backbone Description: Backbone Marker:Cell BioLabs ; Backbone Size:5600; Vector Backbone:pMXs rtv-016; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27565352
Proper citation: RRID:Addgene_83355 Copy
Species: Mus musculus
Genetic Insert: Talin1
Vector Backbone Description: Vector Backbone:pLPCX; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27161398
Comments: XhoI RE site in the vector backbone is disrupted.
F40 refers to the 40-aa peptide (GPGGA)8 derived from the elastic spider silk protein flagelliform
Proper citation: RRID:Addgene_83376 Copy
Species: Synthetic
Genetic Insert: PP4
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression, RNA transcription; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22492509
Proper citation: RRID:Addgene_83329 Copy
Species: Synthetic
Genetic Insert: PP3
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression, RNA transcription; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22492509
Proper citation: RRID:Addgene_83328 Copy
Species: Homo sapiens
Genetic Insert: human DNA-PKcs
Vector Backbone Description: Backbone Size:4665; Vector Backbone:pcmv6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16314509
Proper citation: RRID:Addgene_83317 Copy
Vector Backbone Description: Backbone Marker:Rubin Lab; Backbone Size:11386; Vector Backbone:pBPGw; Vector Types:Insect Expression, Luciferase; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:28245922
Comments: VanGlow-GL-promoter is a Gateway compatible vector enabling high throughput cloning of promoter elements upstream of a GFP::Luciferase(nls) reporter protein (codon optimized for expression in Drosophila) using Invitrogen LR clonase. This vector can be used for Luciferase assays in S2 cells and can be inserted into specific target sites in the Drosophila genome using PhiC31 integrase and used to assess reporter gene expression in vivo using Immunofluorescence, Live-Cell-Imaging, and Luciferase assays. In addition, this vector may be used in combination with other VanGlow transgenes to facilitate FACS purification of specific populations of cells.
Proper citation: RRID:Addgene_83342 Copy
Species: Synthetic
Genetic Insert: PP10
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression, RNA transcription; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22492509
Proper citation: RRID:Addgene_83335 Copy
Species: Homo sapiens
Genetic Insert: XIAP
Vector Backbone Description: Backbone Marker:amersham; Backbone Size:4900; Vector Backbone:pGEX; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10797013
Proper citation: RRID:Addgene_8340 Copy
Species: Synthetic
Genetic Insert: PP6
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression, RNA transcription; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22492509
Proper citation: RRID:Addgene_83331 Copy
Genetic Insert: PAK1-AID-ires-EGFP
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27321921
Proper citation: RRID:Addgene_83489 Copy
Species: Leptotrichia buccalis
Genetic Insert: Lbu_C2c2_WT
Vector Backbone Description: Backbone Size:5960; Vector Backbone:p2CT; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27669025
Comments: Codon optimized for E. Coli expression. His-MBP fusion tag can be removed with TEV protease.
Proper citation: RRID:Addgene_83482 Copy
Species: Listeria seeligeri
Genetic Insert: Lse_C2c2_WT
Vector Backbone Description: Backbone Size:5960; Vector Backbone:p2CT; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27669025
Comments: Codon optimized for E. Coli expression. His-MBP fusion tag can be removed with TEV protease.
Proper citation: RRID:Addgene_83486 Copy
Species: Homo sapiens
Genetic Insert: DLD
Vector Backbone Description: Backbone Marker:PMID: 26186194; Backbone Size:10056; Vector Backbone:pPHAGE C-TAP; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29128334
Comments: Mutation (first described in PMID: 17404228) was created using the method described in PMID: 17446874. Two outer (F: CTCTTGGTTTGCATTGGCCG, IRES_R: CCTCACATTGCCAAAAGACG) and two mutation-site primers were used. The mutated PCR product and the backbone vector were digested using EcoRI, gel purified and ligated.
Note that the mutation is numbered in accordance with the original publication (PMID: 17404228), which lacked the mitochondrial targeting signal (residues 1-35). In this full-length protein, it is found at position 491.
Proper citation: RRID:Addgene_83479 Copy
Species: Gallus gallus
Genetic Insert: FRNK
Vector Backbone Description: Backbone Marker:GE-Healthcare; Backbone Size:12769; Vector Backbone:TRIPZ-non-silencing shRNA control; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26216901
Proper citation: RRID:Addgene_83472 Copy
Species: Homo sapiens
Genetic Insert: SOD1
Vector Backbone Description: Backbone Marker:David Root; Backbone Size:10065; Vector Backbone:pLEX_307 (plasmid #41392); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29128334
Comments: PCR cloning (F: TAAGCAGCTAGCAGCTCAGATCTCGAGCTCAAGC, R: TAAGCAACTAGTTCATTGGGCGATCCCAATTACACC) followed by cleanup, NheI/SpeI restriction digestion of PCR product and destination vector, gel purification and ligation.
Proper citation: RRID:Addgene_83446 Copy
Species: Mus musculus
Genetic Insert: CALR
Vector Backbone Description: Vector Backbone:pmcsg7; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19959473
Proper citation: RRID:Addgene_83505 Copy
Species: Synthetic
Genetic Insert: Barcode23
Vector Backbone Description: Vector Backbone:MSCV; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27617390
Proper citation: RRID:Addgene_83700 Copy
Species: Synthetic
Genetic Insert: Barcode30
Vector Backbone Description: Vector Backbone:MSCV; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27617390
Proper citation: RRID:Addgene_83707 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.