Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 366 showing 7301 ~ 7320 out of 32,424 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_83176

    This resource has 1+ mentions.

http://www.addgene.org/83176

Species: Homo sapiens
Genetic Insert: NRAS
Vector Backbone Description: Backbone Size:2693; Vector Backbone:pDonor-255; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin

Proper citation: RRID:Addgene_83176 Copy   


  • RRID:Addgene_83178

    This resource has 1+ mentions.

http://www.addgene.org/83178

Species: Homo sapiens
Genetic Insert: NRAS
Vector Backbone Description: Backbone Size:2693; Vector Backbone:pDonor-255; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin

Proper citation: RRID:Addgene_83178 Copy   


  • RRID:Addgene_83355

    This resource has 10+ mentions.

http://www.addgene.org/83355

Genetic Insert: 3XMyc-EGFP-OMP25
Vector Backbone Description: Backbone Marker:Cell BioLabs ; Backbone Size:5600; Vector Backbone:pMXs rtv-016; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27565352

Proper citation: RRID:Addgene_83355 Copy   


  • RRID:Addgene_83376

    This resource has 1+ mentions.

http://www.addgene.org/83376

Species: Mus musculus
Genetic Insert: Talin1
Vector Backbone Description: Vector Backbone:pLPCX; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27161398
Comments: XhoI RE site in the vector backbone is disrupted. F40 refers to the 40-aa peptide (GPGGA)8 derived from the elastic spider silk protein flagelliform

Proper citation: RRID:Addgene_83376 Copy   


  • RRID:Addgene_83329

    This resource has 1+ mentions.

http://www.addgene.org/83329

Species: Synthetic
Genetic Insert: PP4
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression, RNA transcription; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22492509

Proper citation: RRID:Addgene_83329 Copy   


  • RRID:Addgene_83328

    This resource has 1+ mentions.

http://www.addgene.org/83328

Species: Synthetic
Genetic Insert: PP3
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression, RNA transcription; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22492509

Proper citation: RRID:Addgene_83328 Copy   


  • RRID:Addgene_83317

    This resource has 1+ mentions.

http://www.addgene.org/83317

Species: Homo sapiens
Genetic Insert: human DNA-PKcs
Vector Backbone Description: Backbone Size:4665; Vector Backbone:pcmv6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16314509

Proper citation: RRID:Addgene_83317 Copy   


  • RRID:Addgene_83342

    This resource has 1+ mentions.

http://www.addgene.org/83342

Vector Backbone Description: Backbone Marker:Rubin Lab; Backbone Size:11386; Vector Backbone:pBPGw; Vector Types:Insect Expression, Luciferase; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:28245922
Comments: VanGlow-GL-promoter is a Gateway compatible vector enabling high throughput cloning of promoter elements upstream of a GFP::Luciferase(nls) reporter protein (codon optimized for expression in Drosophila) using Invitrogen LR clonase. This vector can be used for Luciferase assays in S2 cells and can be inserted into specific target sites in the Drosophila genome using PhiC31 integrase and used to assess reporter gene expression in vivo using Immunofluorescence, Live-Cell-Imaging, and Luciferase assays. In addition, this vector may be used in combination with other VanGlow transgenes to facilitate FACS purification of specific populations of cells.

Proper citation: RRID:Addgene_83342 Copy   


  • RRID:Addgene_83335

    This resource has 1+ mentions.

http://www.addgene.org/83335

Species: Synthetic
Genetic Insert: PP10
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression, RNA transcription; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22492509

Proper citation: RRID:Addgene_83335 Copy   


  • RRID:Addgene_8340

    This resource has 1+ mentions.

http://www.addgene.org/8340

Species: Homo sapiens
Genetic Insert: XIAP
Vector Backbone Description: Backbone Marker:amersham; Backbone Size:4900; Vector Backbone:pGEX; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10797013

Proper citation: RRID:Addgene_8340 Copy   


  • RRID:Addgene_83331

    This resource has 1+ mentions.

http://www.addgene.org/83331

Species: Synthetic
Genetic Insert: PP6
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression, RNA transcription; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22492509

Proper citation: RRID:Addgene_83331 Copy   


http://www.addgene.org/83489

Genetic Insert: PAK1-AID-ires-EGFP
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27321921

Proper citation: RRID:Addgene_83489 Copy   


  • RRID:Addgene_83482

    This resource has 10+ mentions.

http://www.addgene.org/83482

Species: Leptotrichia buccalis
Genetic Insert: Lbu_C2c2_WT
Vector Backbone Description: Backbone Size:5960; Vector Backbone:p2CT; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27669025
Comments: Codon optimized for E. Coli expression. His-MBP fusion tag can be removed with TEV protease.

Proper citation: RRID:Addgene_83482 Copy   


  • RRID:Addgene_83486

    This resource has 1+ mentions.

http://www.addgene.org/83486

Species: Listeria seeligeri
Genetic Insert: Lse_C2c2_WT
Vector Backbone Description: Backbone Size:5960; Vector Backbone:p2CT; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27669025
Comments: Codon optimized for E. Coli expression. His-MBP fusion tag can be removed with TEV protease.

Proper citation: RRID:Addgene_83486 Copy   


  • RRID:Addgene_83479

    This resource has 1+ mentions.

http://www.addgene.org/83479

Species: Homo sapiens
Genetic Insert: DLD
Vector Backbone Description: Backbone Marker:PMID: 26186194; Backbone Size:10056; Vector Backbone:pPHAGE C-TAP; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29128334
Comments: Mutation (first described in PMID: 17404228) was created using the method described in PMID: 17446874. Two outer (F: CTCTTGGTTTGCATTGGCCG, IRES_R: CCTCACATTGCCAAAAGACG) and two mutation-site primers were used. The mutated PCR product and the backbone vector were digested using EcoRI, gel purified and ligated. Note that the mutation is numbered in accordance with the original publication (PMID: 17404228), which lacked the mitochondrial targeting signal (residues 1-35). In this full-length protein, it is found at position 491.

Proper citation: RRID:Addgene_83479 Copy   


  • RRID:Addgene_83472

    This resource has 1+ mentions.

http://www.addgene.org/83472

Species: Gallus gallus
Genetic Insert: FRNK
Vector Backbone Description: Backbone Marker:GE-Healthcare; Backbone Size:12769; Vector Backbone:TRIPZ-non-silencing shRNA control; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26216901

Proper citation: RRID:Addgene_83472 Copy   


  • RRID:Addgene_83446

    This resource has 1+ mentions.

http://www.addgene.org/83446

Species: Homo sapiens
Genetic Insert: SOD1
Vector Backbone Description: Backbone Marker:David Root; Backbone Size:10065; Vector Backbone:pLEX_307 (plasmid #41392); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29128334
Comments: PCR cloning (F: TAAGCAGCTAGCAGCTCAGATCTCGAGCTCAAGC, R: TAAGCAACTAGTTCATTGGGCGATCCCAATTACACC) followed by cleanup, NheI/SpeI restriction digestion of PCR product and destination vector, gel purification and ligation.

Proper citation: RRID:Addgene_83446 Copy   


  • RRID:Addgene_83505

    This resource has 1+ mentions.

http://www.addgene.org/83505

Species: Mus musculus
Genetic Insert: CALR
Vector Backbone Description: Vector Backbone:pmcsg7; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19959473

Proper citation: RRID:Addgene_83505 Copy   


http://www.addgene.org/83700

Species: Synthetic
Genetic Insert: Barcode23
Vector Backbone Description: Vector Backbone:MSCV; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27617390

Proper citation: RRID:Addgene_83700 Copy   


http://www.addgene.org/83707

Species: Synthetic
Genetic Insert: Barcode30
Vector Backbone Description: Vector Backbone:MSCV; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27617390

Proper citation: RRID:Addgene_83707 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X