Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Genetic Insert: PHAkt
Vector Backbone Description: Vector Backbone:pHR; Vector Types:Lentiviral, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21909100
Proper citation: RRID:Addgene_50837 Copy
Species: Arabidopsis thaliana
Genetic Insert: PhyB 1-908
Vector Backbone Description: Vector Backbone:pHR; Vector Types:Lentiviral, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21909100
Comments: Please note this plasmid is a crucial component of the system described in this additional reference: Toettcher JE, Weiner OD, Lim WA, Cell. 2013 Dec 5;155(6):1422-34. doi: 10.1016/j.cell.2013.11.004. (PMID 24315106)
Proper citation: RRID:Addgene_50839 Copy
Species: Synthetic
Genetic Insert: oChIEF(E163A/T199C)
Vector Backbone Description: Backbone Marker:custom; Backbone Size:5100; Vector Backbone:pAAV-CaMKIIa-WPRE-HGHpA; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Comments: The addition of the E163A and T199C mutations in oChIEF impart higher photocurrent amplitude while retaining fast kinetic properties. This variant is proposed as an alternative to ChETA variants that exhibit smaller photocurrents and more toxicity.
Proper citation: RRID:Addgene_51092 Copy
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:8089; Vector Backbone:pSIR; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25051498
Proper citation: RRID:Addgene_51135 Copy
Species: Synthetic
Genetic Insert: ChIEF(E162A/T198C)
Vector Backbone Description: Backbone Marker:custom; Backbone Size:1047; Vector Backbone:pAAV-EF1a-DIO-WPRE-BGHpA; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Comments: The addition of the E162A and T198C mutations in ChIEF impart higher photocurrent amplitude while retaining fast kinetic properties. This variant is proposed as an alternative to ChETA variants that exhibit smaller photocurrents and more toxicity.
Proper citation: RRID:Addgene_51095 Copy
Species: Homo sapiens
Genetic Insert: ubc13
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5800; Vector Backbone:PETSUMO; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22367539
Proper citation: RRID:Addgene_51131 Copy
Species: Homo sapiens
Genetic Insert: Cin85
Vector Backbone Description: Backbone Marker:Origene; Backbone Size:6600; Vector Backbone:pCMV6-AN-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments:
Proper citation: RRID:Addgene_51137 Copy
Species: Synthetic
Genetic Insert: NOSp-NPTII-OCST
Vector Backbone Description: Backbone Marker:Sylvestre Marillonnet; Vector Backbone:pICH47732; Vector Types:; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_51144 Copy
Species: Homo sapiens
Genetic Insert: optimized sgRNA
Vector Backbone Description: Vector Backbone:pSico; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24360272
Comments: gRNA target sequence GTGGCGTGACCTGTGGATGCTG
Proper citation: RRID:Addgene_51025 Copy
Species: Homo sapiens
Genetic Insert: Optimized sgRNA
Vector Backbone Description: Vector Backbone:pSico; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24360272
Comments: gRNA target sequence GTTAGGGTTAGGGTTAGGGTTA
Proper citation: RRID:Addgene_51024 Copy
Species: Synthetic
Genetic Insert: NOSp-BAR-NOST
Vector Backbone Description: Backbone Marker:Sylvestre Marillonnet; Vector Backbone:pICH47732; Vector Types:; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_51145 Copy
Genetic Insert: oChD-citrine
Vector Backbone Description: Backbone Size:4599; Vector Backbone:AAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19254539
Comments: WPRE is inserted after the citrine before SV40 polyA.
Proper citation: RRID:Addgene_50976 Copy
Species: Synthetic
Genetic Insert: ChEF-citrine
Vector Backbone Description: Backbone Size:4599; Vector Backbone:AAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19254539
Comments: WPRE is inserted after the citrine before SV40 polyA.
Proper citation: RRID:Addgene_50975 Copy
Species: Synthetic
Genetic Insert: ChIEF-tdTomato
Vector Backbone Description: Backbone Size:4599; Vector Backbone:AAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19254539
Proper citation: RRID:Addgene_50977 Copy
Species: Escherichia coli
Genetic Insert: AcrR
Vector Backbone Description: Vector Backbone:pET21a; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24316737
Comments: UCSF Case No. SF11-016-2; U.S. Patent Application 13/489,205. GeneArt inserted the synthesized fragment into a pET21a vector.
Proper citation: RRID:Addgene_51148 Copy
Species: Homo sapiens
Genetic Insert: RALB
Vector Backbone Description: Vector Backbone:pLA; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24056301
Proper citation: RRID:Addgene_50989 Copy
Species: Homo sapiens
Genetic Insert: RALB
Vector Backbone Description: Vector Backbone:pLA; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24056301
Proper citation: RRID:Addgene_50983 Copy
Species: Homo sapiens
Genetic Insert: RALB
Vector Backbone Description: Vector Backbone:pLA; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24056301
Proper citation: RRID:Addgene_50982 Copy
Species: Homo sapiens
Genetic Insert: sgRNA library (enriched for ribosomal targets)
Vector Backbone Description: Backbone Marker:based on pLX304 (Root lab); Backbone Size:7500; Vector Backbone:pLX-sgRNA; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24336569
Comments: The library is supplied as pooled DNA. You will receive 1 microgram of DNA in a volume of ~20 microliters.
IMPORTANT NOTE: Though each sub-pool is enriched for its respective target sgRNAs, they are not exclusive and elements of the entire library may be present in each sub-pool.
The backbone of this library is pLX-sgRNA (http://www.addgene.org/50662). See map below.
Proper citation: RRID:Addgene_51045 Copy
Species: Homo sapiens
Genetic Insert: sgRNA library (enriched for kinase targets)
Vector Backbone Description: Backbone Marker:based on pLX304 (Root lab); Backbone Size:7500; Vector Backbone:pLX-sgRNA; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24336569
Comments: The library is supplied as pooled DNA. You will receive 1 microgram of DNA in a volume of ~20 microliters.
IMPORTANT NOTE: Though each sub-pool is enriched for its respective target sgRNAs, they are not exclusive and elements of the entire library may be present in each sub-pool.
The backbone of this library is pLX-sgRNA (http://www.addgene.org/50662). See map below.
Proper citation: RRID:Addgene_51044 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.