Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
Hs.NRAS G12D Resource Report Resource Website 1+ mentions |
RRID:Addgene_83176 | NRAS | Homo sapiens | Spectinomycin | Backbone Size:2693; Vector Backbone:pDonor-255; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin | G12D | 2026-08-15 01:21:03 | 2 | ||
|
Hs.NRAS Q61L Resource Report Resource Website 1+ mentions |
RRID:Addgene_83178 | NRAS | Homo sapiens | Spectinomycin | Backbone Size:2693; Vector Backbone:pDonor-255; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin | Q61L | 2026-08-15 01:21:03 | 1 | ||
|
pMXs-3XMyc-EGFP-OMP25 Resource Report Resource Website 10+ mentions |
RRID:Addgene_83355 | 3XMyc-EGFP-OMP25 | Ampicillin | PMID:27565352 | Backbone Marker:Cell BioLabs ; Backbone Size:5600; Vector Backbone:pMXs rtv-016; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:21:04 | 10 | |||
|
Talin-TS Resource Report Resource Website 1+ mentions |
RRID:Addgene_83376 | Talin1 | Mus musculus | Ampicillin | PMID:27161398 | XhoI RE site in the vector backbone is disrupted. F40 refers to the 40-aa peptide (GPGGA)8 derived from the elastic spider silk protein flagelliform | Vector Backbone:pLPCX; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | Tension sensor module is inserted between V447 and A448 | 2026-08-15 01:21:04 | 1 |
|
Pentaprobe PP4 Resource Report Resource Website 1+ mentions |
RRID:Addgene_83329 | PP4 | Synthetic | Ampicillin | PMID:22492509 | Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression, RNA transcription; Bacterial Resistance:Ampicillin | 2026-08-15 01:21:04 | 1 | ||
|
Pentaprobe PP3 Resource Report Resource Website 1+ mentions |
RRID:Addgene_83328 | PP3 | Synthetic | Ampicillin | PMID:22492509 | Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression, RNA transcription; Bacterial Resistance:Ampicillin | 2026-08-15 01:21:07 | 1 | ||
|
hu DNA-PKcs Resource Report Resource Website 1+ mentions |
RRID:Addgene_83317 | human DNA-PKcs | Homo sapiens | Ampicillin | PMID:16314509 | Backbone Size:4665; Vector Backbone:pcmv6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | wild type | 2026-08-15 01:21:04 | 3 | |
|
VanGlow-GL Resource Report Resource Website 1+ mentions |
RRID:Addgene_83342 | Chloramphenicol and Ampicillin | PMID:28245922 | VanGlow-GL-promoter is a Gateway compatible vector enabling high throughput cloning of promoter elements upstream of a GFP::Luciferase(nls) reporter protein (codon optimized for expression in Drosophila) using Invitrogen LR clonase. This vector can be used for Luciferase assays in S2 cells and can be inserted into specific target sites in the Drosophila genome using PhiC31 integrase and used to assess reporter gene expression in vivo using Immunofluorescence, Live-Cell-Imaging, and Luciferase assays. In addition, this vector may be used in combination with other VanGlow transgenes to facilitate FACS purification of specific populations of cells. | Backbone Marker:Rubin Lab; Backbone Size:11386; Vector Backbone:pBPGw; Vector Types:Insect Expression, Luciferase; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:21:07 | 2 | |||
|
Pentaprobe PP10 Resource Report Resource Website 1+ mentions |
RRID:Addgene_83335 | PP10 | Synthetic | Ampicillin | PMID:22492509 | Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression, RNA transcription; Bacterial Resistance:Ampicillin | 2026-08-15 01:21:04 | 1 | ||
|
pGEX-XIAP Resource Report Resource Website 1+ mentions |
RRID:Addgene_8340 | XIAP | Homo sapiens | Ampicillin | PMID:10797013 | Backbone Marker:amersham; Backbone Size:4900; Vector Backbone:pGEX; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:21:05 | 1 | ||
|
Pentaprobe PP6 Resource Report Resource Website 1+ mentions |
RRID:Addgene_83331 | PP6 | Synthetic | Ampicillin | PMID:22492509 | Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression, RNA transcription; Bacterial Resistance:Ampicillin | 2026-08-15 01:21:07 | 1 | ||
|
pAAV-EF1a-Flex-PAK1-AID-ires-EGFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_83489 | PAK1-AID-ires-EGFP | Ampicillin | PMID:27321921 | Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin | 2026-08-15 01:21:06 | 1 | |||
|
p2CT-His-MBP-Lbu_C2c2_WT Resource Report Resource Website 10+ mentions |
RRID:Addgene_83482 | Lbu_C2c2_WT | Leptotrichia buccalis | Ampicillin | PMID:27669025 | Codon optimized for E. Coli expression. His-MBP fusion tag can be removed with TEV protease. | Backbone Size:5960; Vector Backbone:p2CT; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:21:06 | 15 | |
|
p2CT-His-MBP-Lse_C2c2_WT Resource Report Resource Website 1+ mentions |
RRID:Addgene_83486 | Lse_C2c2_WT | Listeria seeligeri | Ampicillin | PMID:27669025 | Codon optimized for E. Coli expression. His-MBP fusion tag can be removed with TEV protease. | Backbone Size:5960; Vector Backbone:p2CT; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:21:06 | 1 | |
|
pPHAGE_DLD-S456A-C-TAP Resource Report Resource Website 1+ mentions |
RRID:Addgene_83479 | DLD | Homo sapiens | Ampicillin | PMID:29128334 | Mutation (first described in PMID: 17404228) was created using the method described in PMID: 17446874. Two outer (F: CTCTTGGTTTGCATTGGCCG, IRES_R: CCTCACATTGCCAAAAGACG) and two mutation-site primers were used. The mutated PCR product and the backbone vector were digested using EcoRI, gel purified and ligated. Note that the mutation is numbered in accordance with the original publication (PMID: 17404228), which lacked the mitochondrial targeting signal (residues 1-35). In this full-length protein, it is found at position 491. | Backbone Marker:PMID: 26186194; Backbone Size:10056; Vector Backbone:pPHAGE C-TAP; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | S456A | 2026-08-15 01:21:08 | 1 |
|
Tet-FRNK-GFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_83472 | FRNK | Gallus gallus | Ampicillin | PMID:26216901 | Backbone Marker:GE-Healthcare; Backbone Size:12769; Vector Backbone:TRIPZ-non-silencing shRNA control; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | FRNK is the non-catalytic c-term domain of FAK kinase (aa693-1053) | 2026-08-15 01:21:05 | 1 | |
|
pLEX_307-SOD1E133insTT Resource Report Resource Website 1+ mentions |
RRID:Addgene_83446 | SOD1 | Homo sapiens | Ampicillin | PMID:29128334 | PCR cloning (F: TAAGCAGCTAGCAGCTCAGATCTCGAGCTCAAGC, R: TAAGCAACTAGTTCATTGGGCGATCCCAATTACACC) followed by cleanup, NheI/SpeI restriction digestion of PCR product and destination vector, gel purification and ligation. | Backbone Marker:David Root; Backbone Size:10065; Vector Backbone:pLEX_307 (plasmid #41392); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | E133insTT (after GA) | 2026-08-15 01:21:05 | 1 |
|
pmcsg7-mCRT(WT) Resource Report Resource Website 1+ mentions |
RRID:Addgene_83505 | CALR | Mus musculus | Ampicillin | PMID:19959473 | Vector Backbone:pmcsg7; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:21:09 | 2 | ||
|
MSCV-6NBC-GFP-PGK-Puro-Barcode23 Resource Report Resource Website 1+ mentions |
RRID:Addgene_83700 | Barcode23 | Synthetic | Ampicillin | PMID:27617390 | Vector Backbone:MSCV; Vector Types:Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:21:07 | 1 | ||
|
MSCV-6NBC-GFP-PGK-Puro-Barcode30 Resource Report Resource Website 1+ mentions |
RRID:Addgene_83707 | Barcode30 | Synthetic | Ampicillin | PMID:27617390 | Vector Backbone:MSCV; Vector Types:Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:21:07 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
