Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: Cdh10 in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
Comments: For in vitro transcription, use the NotI restriction digest and Sp6 promoter for sense probe generation and the SpeI restriction digest and T7 promoter for antisense probe generation.
Proper citation: RRID:Addgene_45638 Copy
Species: Mus musculus
Genetic Insert: c-Myc T58A
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7143; Vector Backbone:pcDNA DEST40; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15048125
Comments: Alternate plasmid names: pD40-His-c-MycT58A; pcDNA-DEST40 Myc T58A
Plasmid construction information:
Point mutations were introduced into the murine c-Myc sequence in the CMV–Myc plasmid (Hann et al., Genes Dev. 1994, PMID: 7958908) using the GeneEditor kit (Promega) per manufacturer's instructions using oligonucletide
MycT58A, 5′-CTGCTTCCCGCCCCGCCCCTGTC-3′.
The His6-tagged c-MycT58A plasmid was then created by PCR amplification with a CACC 5′ extension added to the 5′ primer for cloning into the TOPO entry clone from Invitrogen (Carlsbad, CA). This sequence was then moved into the pDEST-40 mammalian expression vector using Gateway technology (Invitrogen), creating pD40-His-c-MycT58A.
For more plasmid information (map and sequence), see the wildtype version, pD40-His/V5-c-Myc (Addgene plasmid 45597) For additional usage information, see the associated article (Yeh et al. Nat Cell Biol. 2004) as well as Arnold et al. EMBO 2009 (PMID: 19131971).
Proper citation: RRID:Addgene_45598 Copy
Species: Mus musculus
Genetic Insert: Nnmt in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19793993
Comments: The Nnmt fragment was amplified by RT-PCR using the following primer pair:
CCTATGTGTGTGATCTTGAAGG
AGATCTGCCTGGCTTTCG
For in vitro transcription, use the HindIII restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and Sp6 promoter for antisense probe generation.
Please note that Addgene's sequencing results match bp# 454-908 of NM_010924.2 (and contain a single nucleotide mismatch at bp#816), not bp# 529-983 as indicated on plasmid map. The plasmid functions as described in the associated publication.
Proper citation: RRID:Addgene_45631 Copy
Species: Mus musculus
Genetic Insert: c-Myc S62A
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7143; Vector Backbone:pcDNA DEST40; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15048125
Comments: Alternate plasmid names: pD40-His-c-MycS62A; pcDNA-DEST40 Myc S62A
Plasmid construction information:
Point mutations were introduced into the murine c-Myc sequence in the CMV–Myc plasmid (Hann et al., Genes Dev. 1994, PMID: 7958908) using the GeneEditor kit (Promega) per manufacturer's instructions using oligonucletide
MycS62A, 5′-CACCCCGCCCCTGGCCCCGAGC-3′.
The His6-tagged c-MycS62A plasmid was then created by PCR amplification with a CACC 5′ extension added to the 5′ primer for cloning into the TOPO entry clone from Invitrogen (Carlsbad, CA). This sequence was then moved into the pDEST-40 mammalian expression vector using Gateway technology (Invitrogen), creating pD40-His-c-MycS62A.
For more plasmid information (map and sequence), see the wildtype version, pD40-His/V5-c-Myc (Addgene plasmid 45597) For additional usage information, see the associated article (Yeh et al. Nat Cell Biol. 2004) as well as Arnold et al. EMBO 2009 (PMID: 19131971).
Proper citation: RRID:Addgene_45599 Copy
Species: Mus musculus
Genetic Insert: Chn2 in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19793993
Comments: The Chn2 fragment was amplified by RT-PCR using the following primer pair:
GCATGAGATTTCCACACCAA
TTTCCTTCCATTACACTGTCATAA
For in vitro transcription, use the HindIII restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and Sp6 promoter for antisense probe generation.
Proper citation: RRID:Addgene_45625 Copy
Species: Mus musculus
Genetic Insert: Epha3 in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19793993
Comments: The Epha3 fragment was amplified by RT-PCR using the following primer pair:
GTCCAAATGCCTTAAAATGG
CAATAGCATTTGGCACTTGG
For in vitro transcription, use the HindIII restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and Sp6 promoter for antisense probe generation.
Please note that Addgene's sequencing results match bp# 3179-3773 of NM_010140, not bp# 3180-3774 as indicated on plasmid map. The plasmid functions as described in the associated publication.
Proper citation: RRID:Addgene_45627 Copy
Species: Mus musculus
Genetic Insert: Hspb3 in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19793993
Comments: The Hspb3 fragment was amplified by RT-PCR using the following primer pair:
TGATTCAGCCCCAATTAAGC
CTGGGGTATGAAGAGCAACC
For in vitro transcription, use the HindIII restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and Sp6 promoter for antisense probe generation.
Proper citation: RRID:Addgene_45629 Copy
Species: Mus musculus
Genetic Insert: Cav1 in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19793993
Comments: The Cav1 fragment was amplified by RT-PCR using the following primer pair:
ACCTCTCTGGACTGGCAGAA
AGTGTCGGCAAGACTGAAGG
For in vitro transcription, use the NotI restriction digest and Sp6 promoter for sense probe generation and the Spe1 restriction digest and T7 promoter for antisense probe generation.
Please note that Addgene's sequencing results match bp# 1472-2124 of AB029929.1, but found single nucleotide mismatches at bp# 1501 & 1574. The plasmid functions as described in the associated publication.
Proper citation: RRID:Addgene_45624 Copy
Species: Mus musculus
Genetic Insert: Constitutively active mDia1 (CA-mDia1)
Vector Backbone Description: Backbone Marker:Clontech ; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23677607
Proper citation: RRID:Addgene_45583 Copy
Species: Mus musculus
Genetic Insert: s100a10 in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15664173
Comments: Fragment was amplified using the following primers:
GCCCAGGTTTCGACAGACT
CCACTAGTGATAGAAAGCTCTGGA
For in vitro transcription, use the HindIII restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and SP6 promoter for antisense probe generation.
Please note that Addgene's sequencing results match bp# 21-275 of BC025044, but found single nucleotide mismatches at bp#129 & 190. The plasmid functions as described in the associated publication.
Proper citation: RRID:Addgene_45603 Copy
Species: Mus musculus
Genetic Insert: IFT20
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:16775004
Proper citation: RRID:Addgene_45608 Copy
Species: Mus musculus
Genetic Insert: nAChRAlpha4-SEP
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5472; Vector Backbone:pCI-neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21768117
Comments: PI: Henry Lester
Proper citation: RRID:Addgene_45607 Copy
Species: Mus musculus
Genetic Insert: FoxP1
Vector Backbone Description: Backbone Size:4800; Vector Backbone:pCAGGs; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18662545
Proper citation: RRID:Addgene_45720 Copy
Species: Mus musculus
Genetic Insert: Crym in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15664173
Comments: Fragment was amplified using the following primers:
ACTGGCGAGAACTGGATGAC
GCCATCACCCCTTAACAGAA
For in vitro transcription, use the NotI restriction digest and SP6 promoter for sense probe generation and the HindIII restriction digest and T7 promoter for antisense probe generation.
Proper citation: RRID:Addgene_45601 Copy
Species: Mus musculus
Genetic Insert: Pkhd1
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP-C2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20048263
Proper citation: RRID:Addgene_45560 Copy
Species: Mus musculus
Genetic Insert: Sstr3
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19147004
Proper citation: RRID:Addgene_45559 Copy
Species: Mus musculus
Genetic Insert: Couptf1 in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
Comments: For in vitro transcription, use the HindIII restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and Sp6 promoter for antisense probe generation.
Please note that Addgene's sequencing results match bp# 1755-2381 of NM_010151.2, not bp# 1635-2273 as indicated on plasmid map. The plasmid functions as described in the associated publication.
Proper citation: RRID:Addgene_45870 Copy
Species: Mus musculus
Genetic Insert: Lhx2 in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
Comments: For in vitro transcription, use the NotI restriction digest and Sp6 promoter for sense probe generation and the HindIII restriction digest and T7 promoter for antisense probe generation.
Please note that Addgene's sequencing results match bp# 1809-2217 of NM_010710.3, not bp# 1807-2215 as indicated on plasmid map. The plasmid functions as described in the associated publication.
Proper citation: RRID:Addgene_45873 Copy
Species: Mus musculus
Genetic Insert: Hnrnpa2b1 in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
Comments: For in vitro transcription, use the NotI restriction digest and Sp6 promoter for sense probe generation and the Spe1 restriction digest and T7 promoter for antisense probe generation.
Please note that Addgene's sequencing results match bp# 1145-1370 (with a single nucleotide mismatch at bp#1280) when compared to NM_182650.3, not bp# 1124-1456 as indicated on plasmid map. The plasmid functions as described in the associated publication.
Proper citation: RRID:Addgene_45872 Copy
Species: Mus musculus
Genetic Insert: Semcap3 in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
Comments: For in vitro transcription, use the NotI restriction digest and Sp6 promoter for sense probe generation and the HindIII restriction digest and T7 promoter for antisense probe generation.
Please note that Addgene's sequencing results match bp# 3184-3805 of AF127085.1, not bp# 3185-3804 as indicated on plasmid map. The plasmid functions as described in the associated publication.
Proper citation: RRID:Addgene_45874 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
