Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: Frmd4b in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19793993
Comments: The Frmd4b fragment was amplified by RT-PCR using the following primer pair:
AGCTCCTGAATCGTGGCTTA
TCCTGCAGCTCGGAGTAAAT
For in vitro transcription, use the HindIII restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and Sp6 promoter for antisense probe generation.
Please note that Addgene's sequencing results match bp# 3933-4535 of NM_145148.2, not bp# 3856-4458 as indicated on plasmid map as indicated on plasmid map as indicated on plasmid map. The plasmid functions as described in the associated publication.
Proper citation: RRID:Addgene_45867 Copy
Species: Mus musculus
Genetic Insert: eIF2S2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:11959995
Comments: PCR amplified from GST eIF2beta (addgene plasmid 45900) using EcoRI and BamHI containing primers (+ATG/-STOP).
G321D mutation is also present.
Proper citation: RRID:Addgene_45902 Copy
Species: Mus musculus
Genetic Insert: Btg1 in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19793993
Comments: The Bgt1 fragment was amplified by RT-PCR using the following primer pair:
TGCCATAGTTTGGACAGTACC
CAAAATAGATGGTGGTTTGTGG
For in vitro transcription, use the NotI restriction digest and Sp6 promoter for sense probe generation and the HindIII restriction digest and T7 promoter for antisense probe generation.
Please note that Addgene's sequencing results match bp# 1004-1638 when compared to BC006834.1, not bp# 1004-1638 as indicated on plasmid map as indicated on plasmid map. The plasmid functions as described in the associated publication.
Proper citation: RRID:Addgene_45865 Copy
Species: Mus musculus
Genetic Insert: Nkx6.1
Vector Backbone Description: Vector Backbone:Tet-O-FUW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23584610
Proper citation: RRID:Addgene_45846 Copy
Species: Mus musculus
Genetic Insert: AS9(Mito MTS)-Delta N67-mMCL1
Vector Backbone Description: Backbone Size:6295; Vector Backbone:pMSCV-puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22544066
Proper citation: RRID:Addgene_45822 Copy
Species: Mus musculus
Genetic Insert: mMCL-1
Vector Backbone Description: Backbone Size:6295; Vector Backbone:pMSCV-puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22544066
Proper citation: RRID:Addgene_45817 Copy
Species: Mus musculus
Genetic Insert: 5A, 6A mMCL-1-OM
Vector Backbone Description: Backbone Size:6295; Vector Backbone:pMSCV-puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22544066
Proper citation: RRID:Addgene_45818 Copy
Species: Mus musculus
Genetic Insert: Eif2s2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3500; Vector Backbone:pZeoSV2; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:11959995
Proper citation: RRID:Addgene_45898 Copy
Species: Mus musculus
Genetic Insert: nonmuscle myosin heavy chain II-C, isoform C0
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:16790446
Proper citation: RRID:Addgene_46040 Copy
Species: Mus musculus
Genetic Insert: nonmuscle myosin heavy chain II-C, isoform C2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19240025
Proper citation: RRID:Addgene_46043 Copy
Species: Mus musculus
Genetic Insert: Myocd
Vector Backbone Description: Vector Backbone:tetO-Gateway; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23591016
Proper citation: RRID:Addgene_46033 Copy
Species: Mus musculus
Genetic Insert: p160 myb binding protein
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1 myc-His A; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14744933
Proper citation: RRID:Addgene_46 Copy
Species: Mus musculus
Genetic Insert: Rab35
Vector Backbone Description: Backbone Size:8900; Vector Backbone:pUAST; Vector Types:Insect Expression, Drosophila; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19729655
Proper citation: RRID:Addgene_46015 Copy
Species: Mus musculus
Genetic Insert: Notch1 (C-term)
Vector Backbone Description: Backbone Size:7000; Vector Backbone:pT3-EF1a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22797301
Comments: This plasmid is in the pT3-EF1a vector which contains loxP sites flanking the inverted repeats of SB (sleeping beauty) sequence. Therefore this plasmid cannot not used with Cre for in vivo studies.
For in vivo use in mice with Cre, please use plasmid 86500.
Proper citation: RRID:Addgene_46047 Copy
Species: Mus musculus
Genetic Insert: mCD8GFP
Vector Backbone Description: Backbone Size:9896; Vector Backbone:pQUASp; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27694947
Proper citation: RRID:Addgene_46163 Copy
Species: Mus musculus
Genetic Insert: Map7D1-1783-end
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22425998
Proper citation: RRID:Addgene_46074 Copy
Species: Mus musculus
Genetic Insert: Map7D1-856-1351
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22425998
Proper citation: RRID:Addgene_46072 Copy
Species: Mus musculus
Genetic Insert: Kif5bmotor-Map7emtb
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22425998
Proper citation: RRID:Addgene_46077 Copy
Species: Mus musculus
Genetic Insert: Map7emtb
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22425998
Proper citation: RRID:Addgene_46078 Copy
Species: Mus musculus
Genetic Insert: Map7-1333-end
Vector Backbone Description: Vector Backbone:pGEM-T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22425998
Proper citation: RRID:Addgene_46070 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.