Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pLV-Hyg-Snrnp40-CRISPR-resistant Resource Report Resource Website |
RRID:Addgene_134251 | Snrp40 | Mus musculus | Ampicillin | PMID:31427773 | Backbone Marker:BioSettia; Backbone Size:9200; Vector Backbone:pLV-EF1a -MCS-IRES-Hyg; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | mutated coding sequence “gataactatgcgacgttgaa” to “gaCaaTtaCgcCacCttAaa” | 2026-08-15 01:05:42 | 0 | |
|
pLV-Hyg-Snrnp40-skywarp-CRISPR-resistant Resource Report Resource Website |
RRID:Addgene_134252 | Snrp40 | Mus musculus | Ampicillin | PMID:31427773 | Backbone Size:9200; Vector Backbone:pLV-EF1a -MCS-IRES-Hyg; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | deleted amino acids 179-219, and mutated coding sequence “gataactatgcgacgttgaa” to “gaCaaTtaCgcCacCttAaa” | 2026-08-15 01:05:43 | 0 | |
|
lentiCRISPRv2-Snrnp40 Resource Report Resource Website |
RRID:Addgene_134255 | Snrp40 | Mus musculus | Ampicillin | PMID:31427773 | Backbone Marker:Feng Zhang (Addgene plasmid # 52961); Backbone Size:13000; Vector Backbone:lentiCRISPR v2; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | Snrnp40 gRNA “GATAACTATGCGACGTTGAA” | 2026-08-15 01:05:43 | 0 | |
|
pBOB-C-Flag-GK5_v1 Resource Report Resource Website |
RRID:Addgene_134257 | Gk5 | Mus musculus | Ampicillin | PMID:28607088 | Backbone Size:8800; Vector Backbone:pBOB; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | mouse Gk5 isoform 1; 516 amino acids | 2026-08-15 01:05:42 | 0 | |
|
pB6-Lrig1-T2A-tdTomato-FNF-TK Resource Report Resource Website |
RRID:Addgene_134320 | Lrig1 | Mus musculus | Ampicillin | PMID:32183906 | Homology arms subcloned from a clone of RPCI-24 C57BL/6J mouse genomic DNA library. Please make sure the plasmid DNA preparation is pure by gel electrophoresis before linearizing for an electroporation. Mice available from The Jackson Laboratory (https://www.jax.org/strain/036457). | Backbone Marker:Sen Wu, Capecchi laboratory; Vector Backbone:pWS-TK6; Vector Types:Mouse Targeting; Bacterial Resistance:Ampicillin | 2026-08-15 01:05:43 | 0 | |
|
pWay21-MKP-1CH2AB Resource Report Resource Website |
RRID:Addgene_13475 | MKP-1CH2AB | Mus musculus | Ampicillin | PMID:15899879 | Backbone Size:5800; Vector Backbone:pWay21 EGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Contains aa 1-136 | 2026-08-15 01:05:48 | 0 | |
|
pWay21-MKP-1CH2A Resource Report Resource Website |
RRID:Addgene_13473 | MKP-1CH2A | Mus musculus | Ampicillin | PMID:15899879 | Backbone Size:5800; Vector Backbone:pWay21 EGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Contains aa 1-46 | 2026-08-15 01:05:47 | 0 | |
|
pWay21-MKP-1DCH2AB Resource Report Resource Website |
RRID:Addgene_13472 | MKP-1DCH2AB | Mus musculus | Ampicillin | PMID:15899879 | Backbone Size:5800; Vector Backbone:pWay21 EGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Deletion of MKP-1 CH2AB; contains aa 137-367 | 2026-08-15 01:05:47 | 0 | |
|
pTV-Fbx15 Resource Report Resource Website |
RRID:Addgene_13464 | IRES-Bgeo-pA cassette flanked by Fbx15 homologous arms | Mus musculus | Ampicillin | PMID:12665572 | Backbone Size:3000; Vector Backbone:pBSSK; Vector Types:; Bacterial Resistance:Ampicillin | None | 2026-08-15 01:05:47 | 0 | |
|
pcDNA-GATA3-DC+Nzf Resource Report Resource Website 1+ mentions |
RRID:Addgene_1334 | GATA3 | Mus musculus | Ampicillin | PMID:11021798 | Amino acids 257-341 in GATA-3 were deleted in the DC+Nzf mutant to remove both zinc fingers. | Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:05:35 | 1 | |
|
pAAV2-GCaMP6f-P2A-Vmn1r85 Resource Report Resource Website |
RRID:Addgene_133414 | GCaMP6f-P2A-vmn1r78 | Mus musculus | Ampicillin | PMID:31831669 | pAAV2 : The Hope Center Viral Vectors Core at Washington University in St. Louis GCaMP6f :pGP-CMV-GCaMP6f was a gift from Douglas Kim & GENIE Project (Addgene plasmid # 40755 ; http://n2t.net/addgene:40755 ; RRID:Addgene_40755) | Backbone Size:4619; Vector Backbone:pAAV2; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | 2026-08-15 01:05:35 | 0 | |
|
pAAV2-GCaMP6f-P2A-Vmn1r78 Resource Report Resource Website |
RRID:Addgene_133413 | GCaMP6f-P2A-vmn1r78 | Mus musculus | Ampicillin | PMID:31831669 | pAAV2 : The Hope Center Viral Vectors Core at Washington University in St. Louis GCaMP6f :pGP-CMV-GCaMP6f was a gift from Douglas Kim & GENIE Project (Addgene plasmid # 40755 ; http://n2t.net/addgene:40755 ; RRID:Addgene_40755) | Backbone Size:4619; Vector Backbone:pAAV2; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | 2026-08-15 01:05:35 | 0 | |
|
BII-CMV-AfmW3A Resource Report Resource Website |
RRID:Addgene_133402 | Afamin and Wnt3a | Mus musculus | Ampicillin | PMID:37310750 | Please visit https://doi.org/10.1101/2020.10.14.339531 for bioRxiv preprint. | Backbone Marker:Madison Lab; Vector Backbone:N/A; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | N/A | 2026-08-15 01:05:35 | 0 |
|
pMXs-Dnmt3l Resource Report Resource Website |
RRID:Addgene_13356 | DNA (cytosine-5-)-methyltransferase 3-like | Mus musculus | Ampicillin | PMID:16904174 | The sequence of primer pMX-S1811 is GAC GGC ATC GCA GCT TGG ATA CAC. | Backbone Size:4600; Vector Backbone:pMXs; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | None | 2026-08-15 01:05:37 | 0 |
|
pMXs-Ecat8 Resource Report Resource Website |
RRID:Addgene_13357 | ES cell associated transcript 8 | Mus musculus | Ampicillin | PMID:16904174 | The sequence of primer pMX-S1811 is GAC GGC ATC GCA GCT TGG ATA CAC. | Backbone Size:4600; Vector Backbone:pMXs; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | None | 2026-08-15 01:05:37 | 0 |
|
pMXs-Oct3/4 Resource Report Resource Website 50+ mentions |
RRID:Addgene_13366 | POU domain, class 5, transcription factor 1 | Mus musculus | Ampicillin | PMID:16904174 | The sequence of primer pMX-S1811 is GAC GGC ATC GCA GCT TGG ATA CAC. Mouse Oct3/4 includes C91T mutation. We found that EST clones including substitution C91 to T in NCBI database. So we believe that these substitutions are ascribed to SNPs. CJ069184 RIKEN full-length enriched mouse cDNA library, CRL-2070 CJ069414 RIKEN full-length enriched mouse cDNA library, CRL-2070 As we have shown in the previous our papers, these changes do not affect biological functions of the transcription factors during reprogramming. | Backbone Size:4600; Vector Backbone:pMXs; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | None | 2026-08-15 01:05:38 | 81 |
|
pMXs-Sall4 Resource Report Resource Website |
RRID:Addgene_13361 | sal-like 4 (Drosophila) | Mus musculus | Ampicillin | PMID:16904174 | The sequence of primer pMX-S1811 is GAC GGC ATC GCA GCT TGG ATA CAC. *Note: Addgene's quality control sequencing finds an A950V amino acid residue substitution. The affect of this residue change is not known. | Backbone Size:4600; Vector Backbone:pMXs; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | *(see below) | 2026-08-15 01:05:37 | 0 |
|
pMXs-c-Myc Resource Report Resource Website 50+ mentions |
RRID:Addgene_13375 | myelocytomatosis oncogene | Mus musculus | Ampicillin | PMID:16904174 | The sequence of primer pMX-S1811 is GAC GGC ATC GCA GCT TGG ATA CAC. | Backbone Size:4600; Vector Backbone:pMXs; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | None | 2026-08-15 01:05:39 | 77 |
|
pMXs-c-Myc-T58A Resource Report Resource Website 1+ mentions |
RRID:Addgene_13372 | myelocytomatosis oncogene (T58A mutant) | Mus musculus | Ampicillin | PMID:16904174 | The sequence of primer pMX-S1811 is GAC GGC ATC GCA GCT TGG ATA CAC. | Backbone Size:4600; Vector Backbone:pMXs; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | Tyrosine 58 to Alanine | 2026-08-15 01:05:38 | 5 |
|
pMXs-Stat3-C Resource Report Resource Website 10+ mentions |
RRID:Addgene_13373 | signal transducer and activator of transcription 3 (dominant active mutant) | Mus musculus | Ampicillin | PMID:16904174 | The sequence of primer pMX-S1811 is GAC GGC ATC GCA GCT TGG ATA CAC. | Backbone Size:4600; Vector Backbone:pMXs; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | Changed Alanine 661 to cysteine and asparagine 663 to cysteine, dominant active mutation. | 2026-08-15 01:05:38 | 17 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
