Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
On page 372 showing 7421 ~ 7440 out of 12,972 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

    • RRID:Addgene_34574

    This resource has 1+ mentions.

http://www.addgene.org/34574

Species: Mus musculus
Genetic Insert: Arg1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5597; Vector Backbone:pcDNA3.1 hygro(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_34574 Copy   

    • RRID:Addgene_34573

http://www.addgene.org/34573

Species: Mus musculus
Genetic Insert: Arg1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5597; Vector Backbone:pcDNA3.1 hygro(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_34573 Copy   

    • RRID:Addgene_34579

http://www.addgene.org/34579

Species: Mus musculus
Genetic Insert: Etv3
Vector Backbone Description: Vector Backbone:pMIY; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18025162

Proper citation: RRID:Addgene_34579 Copy   

    • RRID:Addgene_34578

http://www.addgene.org/34578

Species: Mus musculus
Genetic Insert: Etv3
Vector Backbone Description: Vector Backbone:pMIY; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18025162

Proper citation: RRID:Addgene_34578 Copy   

    • RRID:Addgene_34567

    This resource has 1+ mentions.

http://www.addgene.org/34567

Species: Mus musculus
Genetic Insert: C/EBPα
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pWZL Neo; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20368440

Proper citation: RRID:Addgene_34567 Copy   

    • RRID:Addgene_34566

    This resource has 1+ mentions.

http://www.addgene.org/34566

Species: Mus musculus
Genetic Insert: PPARγ2
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pWZL Neo; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20368440

Proper citation: RRID:Addgene_34566 Copy   

    • RRID:Addgene_34678

    This resource has 1+ mentions.

http://www.addgene.org/34678

Species: Mus musculus
Genetic Insert: FoxO1-RFP
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pDsRed-Monomer-N1; Vector Types:; Bacterial Resistance:Kanamycin
Comments: Has L619P polymorphism

Proper citation: RRID:Addgene_34678 Copy   

    • RRID:Addgene_34835

    This resource has 1+ mentions.

http://www.addgene.org/34835

Species: Mus musculus
Genetic Insert: PU.1
Vector Backbone Description: Backbone Marker:Hergen Spits and coworkers; Backbone Size:12443; Vector Backbone:LZRSpBMN-linker-IRES-EGFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11869688

Proper citation: RRID:Addgene_34835 Copy   

    • RRID:Addgene_34706

    This resource has 10+ mentions.

http://www.addgene.org/34706

Species: Mus musculus
Genetic Insert: Drp1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_34706 Copy   

    • RRID:Addgene_34910

    This resource has 1+ mentions.

http://www.addgene.org/34910

Species: Mus musculus
Genetic Insert: presynaptic mGRASP
Vector Backbone Description: Backbone Size:5000; Vector Backbone:paavCAG; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22138823

Proper citation: RRID:Addgene_34910 Copy   

http://www.addgene.org/34912

Species: Mus musculus
Genetic Insert: postsynaptic mGRASP
Vector Backbone Description: Backbone Size:5000; Vector Backbone:paavCAG; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22138823

Proper citation: RRID:Addgene_34912 Copy   

http://www.addgene.org/34911

Species: Mus musculus
Genetic Insert: presynaptic mGRASP
Vector Backbone Description: Backbone Size:5000; Vector Backbone:paavCAG; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22138823

Proper citation: RRID:Addgene_34911 Copy   

    • RRID:Addgene_34857

    This resource has 1+ mentions.

http://www.addgene.org/34857

Species: Mus musculus
Genetic Insert: GluR1
Vector Backbone Description: Backbone Size:5774; Vector Backbone:N/A; Vector Types:Mammalian Expression, Mouse Targeting; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18292343

Proper citation: RRID:Addgene_34857 Copy   

    • RRID:Addgene_34926

    This resource has 1+ mentions.

http://www.addgene.org/34926

Species: Mus musculus
Genetic Insert: CaMKII promoter
Vector Backbone Description: Backbone Size:2948; Vector Backbone:N/A; Vector Types:Mammalian Expression, Mouse Targeting; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_34926 Copy   

    • RRID:Addgene_27700

    This resource has 1+ mentions.

http://www.addgene.org/27700

Species: Mus musculus
Genetic Insert: Hip1R
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:5200; Vector Backbone:pEGFP-N1 (EGFP replaced with tDimer-RFP); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21445324
Comments: Cloned from IMAGE clone: 30535741 (MGC:86079).

Proper citation: RRID:Addgene_27700 Copy   

    • RRID:Addgene_27636

    This resource has 1+ mentions.

http://www.addgene.org/27636

Species: Mus musculus
Genetic Insert: mouse ULK1
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21205641

Proper citation: RRID:Addgene_27636 Copy   

    • RRID:Addgene_27637

    This resource has 1+ mentions.

http://www.addgene.org/27637

Species: Mus musculus
Genetic Insert: mouse ULK2
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21205641

Proper citation: RRID:Addgene_27637 Copy   

http://www.addgene.org/27635

Species: Mus musculus
Genetic Insert: mouse ULK2 shRNA 93
Vector Backbone Description: Backbone Size:7032; Vector Backbone:pLKO; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21205641
Comments: mouse ULK2 shRNA 93 TRC candidate. shRNA oligo sequence - 5'-CCGGCGCCATCTGAACATGATGTTACTCGAGTAACATCATGTTCAGATGGCGTTTTT -3'

Proper citation: RRID:Addgene_27635 Copy   

    • RRID:Addgene_27630

    This resource has 1+ mentions.

http://www.addgene.org/27630

Species: Mus musculus
Genetic Insert: mouse myc ULK1 K46I
Vector Backbone Description: Backbone Size:7341; Vector Backbone:pcDNA 6.2
 V5
 dest
 (Invitrogen); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21205641
Comments: C-term V5 tag not expressed because stop codon at end of ULK1.

Proper citation: RRID:Addgene_27630 Copy   

    • RRID:Addgene_27631

    This resource has 1+ mentions.

http://www.addgene.org/27631

Species: Mus musculus
Genetic Insert: mouse myc ULK1 4SA
Vector Backbone Description: Backbone Size:7341; Vector Backbone:pcDNA 6.2
 V5
 dest
 (Invitrogen); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21205641
Comments: C-term V5 tag not expressed because of stop codon at end of ULK1.

Proper citation: RRID:Addgene_27631 Copy   

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch