Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 372 showing 7421 ~ 7440 out of 32,424 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_55931

    This resource has 1+ mentions.

http://www.addgene.org/55931

Species: Homo sapiens
Genetic Insert: Mito
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mRaspberry; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: . Excitation = 598; Emission = 625

Proper citation: RRID:Addgene_55931 Copy   


  • RRID:Addgene_55944

    This resource has 1+ mentions.

http://www.addgene.org/55944

Species: Homo sapiens
Genetic Insert: ER
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mStrawberry; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: . Excitation = 574; Emission = 596

Proper citation: RRID:Addgene_55944 Copy   


  • RRID:Addgene_56002

    This resource has 1+ mentions.

http://www.addgene.org/56002

Species: Homo sapiens
Genetic Insert: TOMM20
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mPlum-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: . Excitation = 590; Emission = 649

Proper citation: RRID:Addgene_56002 Copy   


  • RRID:Addgene_56005

    This resource has 1+ mentions.

http://www.addgene.org/56005

Species: Homo sapiens
Genetic Insert: VE-Cadherin
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mPlum-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: Excitation = 590; Emission = 649 Addgene QC NGS analysis identifies an I503T discrepancy in the insert sequence. It is unknown what, if any, impact this may have on plasmid function.

Proper citation: RRID:Addgene_56005 Copy   


  • RRID:Addgene_56018

    This resource has 10+ mentions.

http://www.addgene.org/56018

Species: Homo sapiens
Genetic Insert: Mito
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mKeima-Red; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: . Excitation = 440; Emission = 620

Proper citation: RRID:Addgene_56018 Copy   


  • RRID:Addgene_55966

    This resource has 1+ mentions.

http://www.addgene.org/55966

Species: Homo sapiens
Genetic Insert: ER
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mPlum; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: . Excitation = 590; Emission = 649

Proper citation: RRID:Addgene_55966 Copy   


http://www.addgene.org/52985

Species: Synthetic
Genetic Insert: nls-ha-MCP-VenusN-nls-ha-PCP-VenusC
Vector Backbone Description: Backbone Size:6200; Vector Backbone:phage; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24402470

Proper citation: RRID:Addgene_52985 Copy   


  • RRID:Addgene_52904

    This resource has 1+ mentions.

http://www.addgene.org/52904

Vector Backbone Description: Backbone Size:5935; Vector Backbone:pMos3xP3DsRED; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20456509
Comments: attP site is gtagtgccccaactggggtaacctttgagttctctcagttgggggcgtag

Proper citation: RRID:Addgene_52904 Copy   


  • RRID:Addgene_52882

    This resource has 1+ mentions.

http://www.addgene.org/52882

Species: west nile virus
Genetic Insert: prM-E
Vector Backbone Description: Vector Backbone:pPSClo; Vector Types:Unspecified; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_52882 Copy   


  • RRID:Addgene_52924

    This resource has 10+ mentions.

http://www.addgene.org/52924

Genetic Insert: lck-GCaMP6f
Vector Backbone Description: Vector Backbone:pZac2.1; Vector Types:AAV; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_52924 Copy   


http://www.addgene.org/52889

Species: Saccharomyces cerevisiae
Genetic Insert: Gal4
Vector Backbone Description: Backbone Marker:David Strutt (Brittle et al., 2010); Vector Backbone:pAct5-FRT-stop-FRT-SV40polyA attB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25605786

Proper citation: RRID:Addgene_52889 Copy   


  • RRID:Addgene_52920

    This resource has 1+ mentions.

http://www.addgene.org/52920

Species: Homo sapiens
Genetic Insert: shRNA targeting mitogen-activated protein kinase p38
Vector Backbone Description: Vector Backbone:pLKO; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24670723

Proper citation: RRID:Addgene_52920 Copy   


  • RRID:Addgene_52926

    This resource has 1+ mentions.

http://www.addgene.org/52926

Species: Mus musculus
Genetic Insert: mP2X4-pHluorin123
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24935743

Proper citation: RRID:Addgene_52926 Copy   


  • RRID:Addgene_52891

    This resource has 1+ mentions.

http://www.addgene.org/52891

Species: Aedes aegypti
Genetic Insert: polyubiquitin promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4747; Vector Backbone:pGL3; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20456509

Proper citation: RRID:Addgene_52891 Copy   


  • RRID:Addgene_52936

    This resource has 1+ mentions.

http://www.addgene.org/52936

Species: E.coli
Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21189298
Comments: This strain is a precursor to HL 3262 (identical strain, except KanR cassette on chromosome allows for selection).

Proper citation: RRID:Addgene_52936 Copy   


  • RRID:Addgene_52951

    This resource has 1+ mentions.

http://www.addgene.org/52951

Species: E.coli
Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None

Proper citation: RRID:Addgene_52951 Copy   


  • RRID:Addgene_52962

    This resource has 1000+ mentions.

http://www.addgene.org/52962

Species: Synthetic
Genetic Insert: Cas9
Vector Backbone Description: Backbone Size:10130; Vector Backbone:pFUGW; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25075903
Comments: Special note from the Zhang lab: We are constantly improving our CRISPR reagents. Please check https://zlab.bio/ for the most up-to-date information.

Proper citation: RRID:Addgene_52962 Copy   


  • RRID:Addgene_52963

    This resource has 500+ mentions.

http://www.addgene.org/52963

Species: Synthetic
Genetic Insert: S. pyogenes sgRNA cassette
Vector Backbone Description: Vector Backbone:Custom; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25075903
Comments: Note that this plasmid does NOT contain Cas9. It should be used in conjunction with lentiCas9-Blast (Addgene #52962) or otherwise with cell lines already expressing Cas9. Special note from the Zhang lab: We are constantly improving our CRISPR reagents. Please check https://zlab.bio/ for the most up-to-date information.

Proper citation: RRID:Addgene_52963 Copy   


  • RRID:Addgene_52972

    This resource has 1+ mentions.

http://www.addgene.org/52972

Species: Drosophila melanogaster
Genetic Insert: SIK3
Vector Backbone Description: Backbone Size:8904; Vector Backbone:pUAST; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21565616

Proper citation: RRID:Addgene_52972 Copy   


  • RRID:Addgene_52976

    This resource has 1+ mentions.

http://www.addgene.org/52976

Species: Drosophila melanogaster
Genetic Insert: SIK3
Vector Backbone Description: Backbone Size:8904; Vector Backbone:pUAST; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21565616

Proper citation: RRID:Addgene_52976 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X