Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 373 showing 7441 ~ 7460 out of 740,584 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/108020

Species: B. microti
Genetic Insert: BMR1_01g03475
Vector Backbone Description: Backbone Marker:Yves Durocher; Backbone Size:6670; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30367868

Proper citation: RRID:Addgene_108020 Copy   


http://www.addgene.org/108140

Species: Homo sapiens
Genetic Insert: mCherry:SACM1LC389S(1-520):[EAAAR]8:SACM1L(521-587)
Vector Backbone Description: Vector Backbone:pmCherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29461204
Comments: Note: The Sac1 insert contains a Y434F mutation compared to the closest reference sequence (NP_054735.3). The depositor has noted that this is a common point mutation that does not affect plasmid function.

Proper citation: RRID:Addgene_108140 Copy   


http://www.addgene.org/108017

Species: B. microti
Genetic Insert: BMR1_01g00095
Vector Backbone Description: Backbone Marker:Yves Durocher; Backbone Size:6670; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30367868

Proper citation: RRID:Addgene_108017 Copy   


http://www.addgene.org/108135

Species: Homo sapiens
Genetic Insert: mCherry:FKBP1A(3-108):[GGSA]4GG:SACM1L(1-520):[EAAAR]6:SACM1L(521-587)
Vector Backbone Description: Vector Backbone:pmCherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29461204
Comments: Note: The Sac1 insert contains a Y434F mutation compared to the closest reference sequence (NP_054735.3). The depositor has noted that this is a common point mutation that does not affect plasmid function.

Proper citation: RRID:Addgene_108135 Copy   


http://www.addgene.org/108134

Species: Homo sapiens
Genetic Insert: mCherry:FKBP1A(3-108):[GGSA]4GG::SACM1L(1-520):[EAAAR]4:SACM1L(521-587)
Vector Backbone Description: Vector Backbone:pmCherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29461204
Comments: Note: The Sac1 insert contains a Y434F mutation compared to the closest reference sequence (NP_054735.3). The depositor has noted that this is a common point mutation that does not affect plasmid function.

Proper citation: RRID:Addgene_108134 Copy   


http://www.addgene.org/108107

Species: Homo sapiens
Genetic Insert: SIK3
Vector Backbone Description: Backbone Size:7210; Vector Backbone:LentiV_Neo; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29526696

Proper citation: RRID:Addgene_108107 Copy   


http://www.addgene.org/108105

Species: Mus musculus
Genetic Insert: Egr4
Vector Backbone Description: Backbone Size:5086; Vector Backbone:pBabe-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25535333
Comments: The Egr4 gene was transferred from pcDNA3.1-Egr4 (Addgene plasmid 108096) to the pBabe(puro) retroviral vector using EcoRI and SalI sites.

Proper citation: RRID:Addgene_108105 Copy   


  • RRID:Addgene_108104

http://www.addgene.org/108104

Species: Homo sapiens
Genetic Insert: SIK3
Vector Backbone Description: Backbone Size:7210; Vector Backbone:LentiV_Neo; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29526696

Proper citation: RRID:Addgene_108104 Copy   


  • RRID:Addgene_108103

http://www.addgene.org/108103

Species: Homo sapiens
Genetic Insert: SIK3
Vector Backbone Description: Backbone Size:7210; Vector Backbone:LentiV_Neo; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29526696

Proper citation: RRID:Addgene_108103 Copy   


http://www.addgene.org/108102

Species: Mus musculus
Genetic Insert: Egr3
Vector Backbone Description: Backbone Size:5086; Vector Backbone:pBabe-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25535333
Comments: The Egr3 gene was transferred from pcDNA3.1-Egr3 (Addgene plasmid 107998) to the pBabe(puro) retroviral vector using EcoRI and SalI sites.

Proper citation: RRID:Addgene_108102 Copy   


  • RRID:Addgene_108101

    This resource has 10+ mentions.

http://www.addgene.org/108101

Vector Backbone Description: Backbone Size:7210; Vector Backbone:LentiV; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29526696

Proper citation: RRID:Addgene_108101 Copy   


  • RRID:Addgene_108100

    This resource has 50+ mentions.

http://www.addgene.org/108100

Species: Synthetic
Genetic Insert: Cas9
Vector Backbone Description: Backbone Size:7000; Vector Backbone:LentiV_puro; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29526696

Proper citation: RRID:Addgene_108100 Copy   


http://www.addgene.org/108108

Species: Homo sapiens
Genetic Insert: SIK3
Vector Backbone Description: Backbone Size:7210; Vector Backbone:LentiV_Neo; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29526696

Proper citation: RRID:Addgene_108108 Copy   


  • RRID:Addgene_108087

http://www.addgene.org/108087

Species: Mus musculus
Genetic Insert: Vmn2r120
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:3015; Vector Backbone:pGEM-T Easy; Vector Types:in vitro transcription; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29465786

Proper citation: RRID:Addgene_108087 Copy   


  • RRID:Addgene_108086

http://www.addgene.org/108086

Species: Mus musculus
Genetic Insert: Vmn2r118
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:3015; Vector Backbone:pGEM-T Easy; Vector Types:in vitro transcription; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29465786

Proper citation: RRID:Addgene_108086 Copy   


http://www.addgene.org/108117

Species: Mus musculus
Genetic Insert: shRNA to Egr4
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:6445; Vector Backbone:pSirenRetroQ(puro); Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25535333
Comments: For the chosen sequence (AAGTCTTTGGATGTGATGTTT), the annealed oligos are: 5'-gatccAAGTCTTTGGATGTGATGTTTTTCAAGAGAAAACATCACATCCAAAGACTTTTTTTTACGCGTg-----3' 3'-----gTTCAGAAACCTACACTACAAAAAGTTCTCTTTTGTAGTGTAGGTTTCTGAAAAAAAATGCGCActtaa-5'

Proper citation: RRID:Addgene_108117 Copy   


  • RRID:Addgene_108116

    This resource has 1+ mentions.

http://www.addgene.org/108116

Species: B. microti
Genetic Insert: BMR1_01g02031
Vector Backbone Description: Backbone Marker:Yves Durocher; Backbone Size:6670; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30367868

Proper citation: RRID:Addgene_108116 Copy   


http://www.addgene.org/108115

Species: Mus musculus
Genetic Insert: shRNA to Egr3
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:6445; Vector Backbone:pSirenRetroQ(puro); Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25535333
Comments: For the chosen sequence (AATCAATTGCCTGACAATC), the annealed oligos were: 5'-gatccAATCAATTGCCTGACAATCTTCAAGAGAGATTGTCAGGCAATTGATTTTTTTTACGCGTg-----3' 3'-gTTAGTTAACGGACTGTTAGAAGTTCTCTCTAACAGTCCGTTAACTAAAAAAAATGCGCActtaa-5'

Proper citation: RRID:Addgene_108115 Copy   


  • RRID:Addgene_108079

http://www.addgene.org/108079

Species: Mus musculus
Genetic Insert: Vmn2r1-Hprt (5')-loxP-neo
Vector Backbone Description: Backbone Marker:Agilent Technologies/Stratagene; Backbone Size:2900; Vector Backbone:pBluescript II SK+; Vector Types:Mouse Targeting; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29465786

Proper citation: RRID:Addgene_108079 Copy   


  • RRID:Addgene_108111

    This resource has 1+ mentions.

http://www.addgene.org/108111

Species: Homo sapiens
Genetic Insert: LKB1
Vector Backbone Description: Backbone Size:7210; Vector Backbone:LentiV_Neo; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29526696

Proper citation: RRID:Addgene_108111 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X