Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: Myo1E
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1 (EGFP replaced with Apple); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21445324
Comments: Cloned from IMAGE clone: 5053090 (MGC:58876).
Proper citation: RRID:Addgene_27698 Copy
Species: Mus musculus
Genetic Insert: Dynamin 1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21445324
Comments: Cloned from IMAGE clone: 4506865 (MGC:25354).
Proper citation: RRID:Addgene_27697 Copy
Species: Mus musculus
Genetic Insert: Coronin 1B
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21445324
Comments: Cloned from a cDNA library derived from mouse brain.
Proper citation: RRID:Addgene_27694 Copy
Species: Mus musculus
Genetic Insert: FCHo1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pmCherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21445324
Comments: Cloned from IMAGE clone: 5323527 (MGC:38225).
Proper citation: RRID:Addgene_27690 Copy
Species: Mus musculus
Genetic Insert: CALM
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21445324
Comments: Cloned from IMAGE clone: 2651109 (MGC:19382).
This plasmid may be slow growing in bacteria. For difficult constructs you can use TG1s (they are Endonuclease positive, but good for cloning) and INV F' E.coli strains. The latter give the best results. Also when growing in culture try to switch to 2xTY media, which is richer that LB.
Proper citation: RRID:Addgene_27691 Copy
Species: Mus musculus
Genetic Insert: mouse myc ULK1
Vector Backbone Description: Backbone Marker:Addgene plasmid 17399; Backbone Size:9135; Vector Backbone:pQCXIN Neo dest; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21205641
Proper citation: RRID:Addgene_27626 Copy
Species: Mus musculus
Genetic Insert: SNX9
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pmCherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21445324
Comments: Cloned from IMAGE clone: 3257422 (MGC:6327).
Proper citation: RRID:Addgene_27678 Copy
Species: Mus musculus
Genetic Insert: Rab5a
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pmCherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21445324
Comments: Cloned from IMAGE clone: 2649317 (MGC:6509).
Proper citation: RRID:Addgene_27679 Copy
Species: Mus musculus
Genetic Insert: Synaptojanin 2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pmCherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21445324
Comments: Cloned from IMAGE clone: 6390688 (MGC:67830).
Proper citation: RRID:Addgene_27677 Copy
Species: Mus musculus
Genetic Insert: NECAP
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pmCherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21445324
Comments: Cloned from IMAGE clone: 4013043 (MGC:18995).
Proper citation: RRID:Addgene_27674 Copy
Species: Mus musculus
Genetic Insert: Epsin 2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pmCherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21445324
Comments: Cloned from IMAGE clone: 2647379 (MGC:19376).
Proper citation: RRID:Addgene_27673 Copy
Species: Mus musculus
Genetic Insert: FCHo2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pmCherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21445324
Comments: Cloned from IMAGE clone: 6830607 (MGC:63242).
Proper citation: RRID:Addgene_27686 Copy
Species: Mus musculus
Genetic Insert: APPL1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pmCherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21445324
Comments: Cloned from IMAGE clone: 6511401 (MGC:69973).
Proper citation: RRID:Addgene_27683 Copy
Species: Mus musculus
Genetic Insert: Syndapin 2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pmCherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21445324
Comments: Cloned from cDNA library from NIH-3T3 cells.
Proper citation: RRID:Addgene_27681 Copy
Species: Mus musculus
Genetic Insert: Egr1
Vector Backbone Description: Backbone Marker:A.Q. Bakker; Backbone Size:12443; Vector Backbone:LZRSpBMN-linker-IRES-EGFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_27783 Copy
Species: Mus musculus
Genetic Insert: 2.1 kB VEGF
Vector Backbone Description: Backbone Size:5598; Vector Backbone:PGL2 Basic; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15582599
Proper citation: RRID:Addgene_27988 Copy
Species: Mus musculus
Genetic Insert: VEGF
Vector Backbone Description: Backbone Size:5598; Vector Backbone:PGL2 Basic; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15582599
Proper citation: RRID:Addgene_27986 Copy
Species: Mus musculus
Genetic Insert: TNFalpha
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17606866
Proper citation: RRID:Addgene_28089 Copy
Species: Mus musculus
Genetic Insert: PTEN 3'UTR
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5010; Vector Backbone:pGL3-Promoter; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20103531
Comments: Note that Addgene's sequencing result contains a 3 nucleotide deletion (bp# 7639-7641) when compared with GenBank accession number NM_008960.2
PTEN 3'UTR was amplified from Balb/c mouse genomic DNA with the following primer pairs:
F: 5' GCTAGCCCCCCTCCTTG
R: 5' GCTAGCAAAAATAATGAACCTTTTTAATTGTTTAAAGG
PCR products were digested with NheI and subcloned into the XbaI site of the pGL3-promoter vector (Promega)
Proper citation: RRID:Addgene_28104 Copy
Species: Mus musculus
Genetic Insert: Nr5a1 shRNA
Vector Backbone Description: Backbone Marker:Genscript; Backbone Size:6478; Vector Backbone:pRNAT-CMV3.1/Neo; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18388192
Comments: shRNA#2 sequence:
GATCCTAGAGGTAGCCAGCCAGAGGTTTGATATCCGACCTCTGGCTGGCTACCTCTACGC
Proper citation: RRID:Addgene_28187 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
