Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: SF-1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12239114
Comments: This plasmid contains 1601 bp of SF-1 derived cDNA and an additional 10 bp from the AT cloning vector pCR2.1.
Proper citation: RRID:Addgene_28185 Copy
Species: Mus musculus
Genetic Insert: Nr5a1 shRNA
Vector Backbone Description: Backbone Marker:Genscript; Backbone Size:6478; Vector Backbone:pRNAT-CMV3.1/Neo; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18388192
Comments: shRNA #1 sequence: GATCCTAATGCTTGTTGTTCTGGACTTTGATATCCGAGTCCAGAACAACAAGCATTACGC
Proper citation: RRID:Addgene_28186 Copy
Species: Mus musculus
Genetic Insert: SF1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3.1-his; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10770490
Comments: The His-tagged-SF1 (antisense) plasmid, the plasmid was created as a control for the His-tagged-SF1 plasmid (#28182). The SF1 insert was placed in the 3' - 5' orientation downstream of the His tag. As such, the transcript will not encode an open reading frame.
Proper citation: RRID:Addgene_28183 Copy
Species: Mus musculus
Genetic Insert: SF-1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12239114
Comments: This plasmid contains 1601 bp of SF-1 derived cDNA and an additional 10 bp from the AT cloning vector pCR2.1.
Proper citation: RRID:Addgene_28181 Copy
Species: Mus musculus
Genetic Insert: SF1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3.1-his; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10770490
Proper citation: RRID:Addgene_28182 Copy
Species: Mus musculus
Genetic Insert: SF-1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12239114
Comments: This plasmid contains 1601 bp of SF-1 derived cDNA and an additional 10 bp from the AT cloning vector pCR2.1.
Proper citation: RRID:Addgene_28180 Copy
Species: Mus musculus
Genetic Insert: Prkar1a
Vector Backbone Description: Backbone Size:7600; Vector Backbone:pMT-REV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8388994
Comments: Expression vector encoding dominant-negative regulatory subunit of type 1 cAMP-dependent protein kinase.
pMT-REV is a zinc-inducible expression vector driven by the metallothionein promoter.
Proper citation: RRID:Addgene_28178 Copy
Species: Mus musculus
Genetic Insert: Lrh-1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3800; Vector Backbone:pCMV-Myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20734354
Proper citation: RRID:Addgene_28093 Copy
Species: Mus musculus
Genetic Insert: Lrh-1
Vector Backbone Description: Backbone Size:0; Vector Backbone:pEF1a-Luc-IRES-Neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20734354
Proper citation: RRID:Addgene_28092 Copy
Species: Mus musculus
Genetic Insert: Net1A
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pEF-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19586902
Proper citation: RRID:Addgene_28262 Copy
Species: Mus musculus
Genetic Insert: Net1
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pEF-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19586902
Proper citation: RRID:Addgene_28263 Copy
Species: Mus musculus
Genetic Insert: Net1A
Vector Backbone Description: Backbone Marker:Amersham; Backbone Size:5006; Vector Backbone:pGEX-KG; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19586902
Proper citation: RRID:Addgene_28261 Copy
Species: Mus musculus
Genetic Insert: Venus CAM KII Alpha
Vector Backbone Description: Backbone Size:3984; Vector Backbone:pEGFP C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19339497
Proper citation: RRID:Addgene_29431 Copy
Species: Mus musculus
Genetic Insert: Venus CAM KII Alpha
Vector Backbone Description: Backbone Size:3984; Vector Backbone:pEGFP C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19339497
Proper citation: RRID:Addgene_29430 Copy
Species: Mus musculus
Genetic Insert: Venus CAM KII Alpha
Vector Backbone Description: Backbone Size:3984; Vector Backbone:pEGFP C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19339497
Proper citation: RRID:Addgene_29428 Copy
Species: Mus musculus
Genetic Insert: SHIP-1 promoter
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript SK; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15978570
Comments: See attached map ("View Map") and Materials and Methods for complete cloning details.
Proper citation: RRID:Addgene_29459 Copy
Species: Mus musculus
Genetic Insert: Sema3E (mouse)
Vector Backbone Description: Backbone Marker:stratagene; Backbone Size:2900; Vector Backbone:pBLUESCRIPT (KS); Vector Types:pBlue for ISH; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_29453 Copy
Species: Mus musculus
Genetic Insert: SEMA3D
Vector Backbone Description: Backbone Size:3900; Vector Backbone:PCRII; Vector Types:for ISH; Bacterial Resistance:Ampicillin
Comments: Please note that this vector was designed to generate a probe for in situ hybridization (ISH) and is functional for this purpose. The SEMA3D sequence is not full-length and may contain additional mutations when compared to the GenBank reference sequence.
Proper citation: RRID:Addgene_29452 Copy
Species: Mus musculus
Genetic Insert: SEMA3C
Vector Backbone Description: Backbone Marker:stratagene; Backbone Size:3000; Vector Backbone:pBluescript (SK); Vector Types:pBlue for ISH; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_29451 Copy
Species: Mus musculus
Genetic Insert: Kif2A-beta
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4706; Vector Backbone:PEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:15883193
Comments: There is 1 gap and 1 insertion with depositor's reference sequence which results in missing aa R73,A74 and inserted aa AR after aa91 of Kif2a. Depositor believes the mutations in Kif2a are the results of either errors in database sequences or polymorphisms.
Proper citation: RRID:Addgene_29482 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
