Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Unspecified
Genetic Insert: SAGA p15A PrhaBAD BCD_low - gfp - tetAp15A- CmTrunc
Vector Backbone Description: Vector Backbone:pSEVAx61; Vector Types:Synthetic Biology; Bacterial Resistance:Tetracycline
Defining Citation: PMID:40527904
Proper citation: RRID:Addgene_240764 Copy
Species: Unspecified
Genetic Insert: SAGA RK2 PrhaBAD BCD_high - gfp - tetARK2- CmTrunc
Vector Backbone Description: Vector Backbone:pSEVAx21; Vector Types:Synthetic Biology; Bacterial Resistance:Tetracycline
Defining Citation: PMID:40527904
Proper citation: RRID:Addgene_240763 Copy
Species: Unspecified
Genetic Insert: SAGA pBR322-ROP PrhaBAD BCD_medium - gfp -tetApBR322-ROP- CmTrunc
Vector Backbone Description: Vector Backbone:pSEVAx91; Vector Types:Synthetic Biology; Bacterial Resistance:Tetracycline
Defining Citation: PMID:40527904
Proper citation: RRID:Addgene_240768 Copy
Species: Synthetic
Genetic Insert: MMLVgag-dCas9-ZIM3
Vector Backbone Description: Backbone Size:4759; Vector Backbone:pCDNA3-like; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40858609
Proper citation: RRID:Addgene_240527 Copy
Genetic Insert: EGFP
Vector Backbone Description: Vector Backbone:pFC332; Vector Types:Fungal Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_239810 Copy
Species: Homo sapiens
Genetic Insert: Angiotensin II Type 1 Receptor
Vector Backbone Description: Backbone Size:5383; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_240614 Copy
Species: Homo sapiens
Genetic Insert: MAS1 receptor
Vector Backbone Description: Backbone Size:5564; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: We generated the MasR insert by amplification of human genomic DNA with the primers F: CAAGCTTGGTACCGAGCTCGGATCCTACCCATACGATGTTCCAGATTACGCGATGGATGGGTCAAACGTG; R:AGTGTGATGGATATCTGCAGAATTCTTTCATCATTAATTAGTATCTCATGC; this is because the MasR insert is composed of one Exon.
Proper citation: RRID:Addgene_240613 Copy
Genetic Insert: NLS of H3
Vector Backbone Description: Vector Backbone:pFC332; Vector Types:Fungal Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_239812 Copy
Species: Aequorea victoria; Thermus aquaticus, Discosoma sp.
Genetic Insert: cyt-NAPstarC
Vector Backbone Description: Backbone Size:9954; Vector Backbone:pSS02; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39702652
Proper citation: RRID:Addgene_241271 Copy
Species: Aequorea victoria; Thermus aquaticus, Discosoma sp.
Genetic Insert: cyt-NAPstar1
Vector Backbone Description: Backbone Size:9954; Vector Backbone:pSS02; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39702652
Proper citation: RRID:Addgene_241270 Copy
Species: Homo sapiens
Genetic Insert: SIRT4
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7143; Vector Backbone:pcDNA-DEST40; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16079181
Proper citation: RRID:Addgene_242127 Copy
Species: Arabidopsis thaliana
Genetic Insert: PYR1
Vector Backbone Description: Vector Backbone:pBD-GAL4-cam; Vector Types:Yeast Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:19407142
Comments: Cutler lab uses this with yeast strain Mav99 but has tested it with Mav203 (commercially available) and it works well with that strain too. Please visit https://doi.org/10.1101/2025.05.15.654352 for bioRxiv preprint.
Proper citation: RRID:Addgene_241278 Copy
Species: Homo sapiens
Genetic Insert: SIRT5
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7143; Vector Backbone:pcDNA-DEST40; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16079181
Proper citation: RRID:Addgene_242128 Copy
Species: Homo sapiens
Genetic Insert: SIRT2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7143; Vector Backbone:pcDNA-DEST40; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16079181
Proper citation: RRID:Addgene_242125 Copy
Species: Homo sapiens
Genetic Insert: SIRT3
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7143; Vector Backbone:pcDNA-DEST40; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16079181
Proper citation: RRID:Addgene_242126 Copy
Species: Mus musculus
Genetic Insert: U6 driven sgRNA Targeting exon 1 of EZR
Vector Backbone Description: Vector Backbone:pX601; Vector Types:Mammalian Expression, AAV, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36702661
Proper citation: RRID:Addgene_240865 Copy
Species: Homo sapiens
Genetic Insert: SIRT6
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7143; Vector Backbone:pcDNA-DEST40; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16079181
Proper citation: RRID:Addgene_242129 Copy
Genetic Insert: H3
Vector Backbone Description: Vector Backbone:pFC332; Vector Types:Fungal Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_239807 Copy
Species: Homo sapiens
Genetic Insert: pFUW-TetO-EYA1
Vector Backbone Description: Vector Backbone:pFUW-TetO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_207209 Copy
Species: Homo sapiens
Genetic Insert: pFUW-TetO-CREB3L2
Vector Backbone Description: Vector Backbone:pFUW-TetO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_207207 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
