Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 376 showing 7501 ~ 7520 out of 32,424 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_119214

    This resource has 1+ mentions.

http://www.addgene.org/119214

Species: Other
Genetic Insert: split cTEVp in fusion with ABI
Vector Backbone Description: Backbone Size:5443; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30531965

Proper citation: RRID:Addgene_119214 Copy   


  • RRID:Addgene_119213

    This resource has 1+ mentions.

http://www.addgene.org/119213

Species: Other
Genetic Insert: split nTEVp in sufion with PYL1
Vector Backbone Description: Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30531965

Proper citation: RRID:Addgene_119213 Copy   


  • RRID:Addgene_119183

    This resource has 1+ mentions.

http://www.addgene.org/119183

Species: Other
Genetic Insert: HyPer3
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4600; Vector Backbone:pAAV-MCS; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30279532
Comments: Can be used for in vivo expression of the hydrogen peroxide-sensitive fluorescent protein HyPer3. It was used for this purpose in Steinhorn et al. Free Radic Biol Med. 2017 Dec;113:16-25. doi: 10.1016/j.freeradbiomed.2017.09.006. In the associated publication (Steinhorn et al. Nat Commun. 2018 Oct 2;9(1):4044. doi: 10.1038/s41467-018-06533-2), it was used as a control for a virus driving expression of a fusion between HyPer and D-amino acid oxidase.

Proper citation: RRID:Addgene_119183 Copy   


  • RRID:Addgene_119164

    This resource has 1+ mentions.

http://www.addgene.org/119164

Species: R. gracilis
Genetic Insert: HyPer-DAAO-NES
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4600; Vector Backbone:pAAV-MCS; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30279532

Proper citation: RRID:Addgene_119164 Copy   


  • RRID:Addgene_11929

    This resource has 10+ mentions.

http://www.addgene.org/11929

Species: Homo sapiens
Genetic Insert: GalT
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4733; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:8670420
Comments: The EGFP (Clontech Laboratories, Inc., Palo, Alto, CA) contains a valine immediately after the start codon that is not found in the wild type sequence. However, to avoid confusion with previously published work on GFP mutants, the wild type residue numbers are used. This construct contains amino acids 1-60 of the human galactosyltransferase. The original article describes cloning into pcDNA1 ro pCDLSRa. A subsequent paper Zaal et. al. Cell 99:589-601 (1999) describes subcloning into the parent vector used here.

Proper citation: RRID:Addgene_11929 Copy   


  • RRID:Addgene_11951

    This resource has 1+ mentions.

http://www.addgene.org/11951

Genetic Insert: CD3delta-YFP
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3961; Vector Backbone:EGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:16103128
Comments: CD3 delta was PCR amplified from a plasmid, introducing flanking BglII and EcoRI sites, and cloned in Ub-R-YFP digested with BamHI and EcoRI.

Proper citation: RRID:Addgene_11951 Copy   


  • RRID:Addgene_11950

    This resource has 1+ mentions.

http://www.addgene.org/11950

Genetic Insert: YFP-CL1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3932; Vector Backbone:EGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:16103128
Comments: The YFP-CL1 reporter was generated by inserting an oligodimer encoding the 16 amino acid CL1 degradation signal (ACKNWFSSLSHFVIHL) in enhanced GFP-C1 (BD Biosciences Clontech) using the EcoRI and BamH1 restriction sites, then the enhanced GFP open-reading frame was replaced with YFP using the Nhe1 and SspB1 restriction sites.

Proper citation: RRID:Addgene_11950 Copy   


  • RRID:Addgene_11952

    This resource has 1+ mentions.

http://www.addgene.org/11952

Genetic Insert: Ub-M-GFP
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5830; Vector Backbone:pYES2; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14644450
Comments: The ubiquitin open reading frame was amplified by PCR from the Ub-Pro-Gal plasmid with the sense primer 5'-GCG GAATTCACCATGCAGATCTTCGTGAAGACT-3' and the antisense primer 5'-GCG GGATCCTGTCGACCAAGCTTCCCXXX CCCACCTCTGAGACGGAGTAC-3' where the XXX leads to a Methionine at position 1 (see article 10802622, Figure 1). The PCR product was cloned into the EcoRI and BamHI sites of the EGFP-N1 vector from Clontech. The Ub-M-GFP insert was then excised with EcoRI and NotI and cloned into pYES2.

Proper citation: RRID:Addgene_11952 Copy   


  • RRID:Addgene_11954

    This resource has 1+ mentions.

http://www.addgene.org/11954

Genetic Insert: Ub-G76V-GFP
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5830; Vector Backbone:pYES2; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14644450
Comments: The ubiquitin open reading frame was amplified by PCR from the Ub-Pro-Gal plasmid with the sense primer 5'-GCG GAATTCACCATGCAGATCTTCGTGAAGACT-3' and the antisense primer 5'-GCGGGATCCTGTCGACCAAGCTTC CCCACCACACCTCTGAGACGGAGTAC-3'. The PCR product was cloned into the EcoRI and BamHI sites of the EGFP-N1 vector from Clontech. The Ub-G76V-GFP insert was then excised with EcoRI and NotI and cloned into pYES2.

Proper citation: RRID:Addgene_11954 Copy   


  • RRID:Addgene_11931

    This resource has 1+ mentions.

http://www.addgene.org/11931

Species: Homo sapiens
Genetic Insert: GalT
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4733; Vector Backbone:pEYFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:8670420
Comments: Venus was developed by Miyawaki and colleagues. The reference is Nagai, T., Ibata, K., Park, E. S., Kubota, M., Mikoshiba, K., and Miyawaki, A. (2002) Nat Biotechnol 20, 87-90. The EYFP (Clontech Laboratories, Inc., Palo, Alto, CA) contains a valine immediately after the start codon that is not found in the wild type sequence. However, to avoid confusion with previously published work on GFP mutants, the wild type residue numbers are used. This construct contains amino acids 1-60 of the human galactosyltransferase. The original article describes cloning into pcDNA1 ro pCDLSRa. A subsequent paper Zaal et. al. Cell 99:589-601 (1999) describes subcloning into the parent vector used here.

Proper citation: RRID:Addgene_11931 Copy   


  • RRID:Addgene_11930

    This resource has 1+ mentions.

http://www.addgene.org/11930

Species: Homo sapiens
Genetic Insert: GalT
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4733; Vector Backbone:pECFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:8670420
Comments: Cerulean ws developed by Piston lab. Reference is Rizzo, M. A., Springer, G. H., Granada, B., and Piston, D. W. (2004) Nat Biotechnol 22, 445-9. The EGFP (Clontech Laboratories, Inc., Palo, Alto, CA) contains a valine immediately after the start codon that is not found in the wild type sequence. However, to avoid confusion with previously published work on GFP mutants, the wild type residue numbers are used. This construct contains amino acids 1-60 of the human galactosyltransferase. The original article describes cloning into pcDNA1 ro pCDLSRa. A subsequent paper Zaal et. al. Cell 99:589-601 (1999) describes subcloning into the parent vector used here.

Proper citation: RRID:Addgene_11930 Copy   


  • RRID:Addgene_11937

    This resource has 1+ mentions.

http://www.addgene.org/11937

Species: Homo sapiens
Genetic Insert: GalT
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4733; Vector Backbone:pECFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:8670420
Comments: This construct contains amino acids 1-60 of the human galactosyltransferase. The original article describes cloning into pcDNA1 or pCDLSRa. A subsequent paper Zaal et. al. Cell 99:589-601 (1999) describes subcloning into the parent vector used here. Addgene Note: Please see the Addgene sequencing result to view the fluorophore sequence.

Proper citation: RRID:Addgene_11937 Copy   


  • RRID:Addgene_11936

    This resource has 1+ mentions.

http://www.addgene.org/11936

Species: Homo sapiens
Genetic Insert: GalT
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4733; Vector Backbone:pEYFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:8670420
Comments: This construct contains amino acids 1-60 of the human galactosyltransferase. The original article describes cloning into pcDNA1 ro pCDLSRa. A subsequent paper Zaal et. al. Cell 99:589-601 (1999) describes subcloning into the parent vector used here.

Proper citation: RRID:Addgene_11936 Copy   


  • RRID:Addgene_11933

    This resource has 1+ mentions.

http://www.addgene.org/11933

Species: Homo sapiens
Genetic Insert: Ubiquitin
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4500; Vector Backbone:EGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:16606690
Comments: PAGFP is a photoactivatable version of GFP. It is essentially the same as the standard EGFP-C1 from clontech, but contains the mutations L64F/T65S/V163A/T203H, and conatins an A206K mutation to disrupt dimerization. In total, the PAGFP-Ubiquitin insert is 983bp.

Proper citation: RRID:Addgene_11933 Copy   


  • RRID:Addgene_11932

    This resource has 1+ mentions.

http://www.addgene.org/11932

Species: Homo sapiens
Genetic Insert: Ubiquitin KO.G76V
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4731; Vector Backbone:EGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:16606690

Proper citation: RRID:Addgene_11932 Copy   


  • RRID:Addgene_11935

    This resource has 10+ mentions.

http://www.addgene.org/11935

Species: Homo sapiens
Genetic Insert: Ubiquitin
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4500; Vector Backbone:EGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:16702407

Proper citation: RRID:Addgene_11935 Copy   


  • RRID:Addgene_11934

    This resource has 1+ mentions.

http://www.addgene.org/11934

Species: Homo sapiens
Genetic Insert: Ubiquitin KO
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4731; Vector Backbone:EGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:16702407

Proper citation: RRID:Addgene_11934 Copy   


http://www.addgene.org/119316

Species: Homo sapiens
Genetic Insert: E6-AP I
Vector Backbone Description: Backbone Size:7818; Vector Backbone:PHAGE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30257870

Proper citation: RRID:Addgene_119316 Copy   


  • RRID:Addgene_11941

    This resource has 10+ mentions.

http://www.addgene.org/11941

Genetic Insert: Ub-G76V-GFP
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3970; Vector Backbone:EGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:10802622
Comments: The ubiquitin open reading frame was amplified by PCR from the Ub-Pro-Gal plasmid with the sense primer 5'-GCG GAATTCACCATGCAGATCTTCGTGAAGACT-3' and the antisense primer 5'-GCGGGATCCTGTCGACCAAGCTTC CCCACCACACCTCTGAGACGGAGTAC-3'. The PCR product was cloned into the EcoRI and BamHI sites of the EGFP-N1 vector from Clontech.

Proper citation: RRID:Addgene_11941 Copy   


http://www.addgene.org/119311

Species: Homo sapiens
Genetic Insert: E6-AP I
Vector Backbone Description: Backbone Size:7818; Vector Backbone:PHAGE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30257870

Proper citation: RRID:Addgene_119311 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X