Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
R5 MCS Resource Report Resource Website |
RRID:Addgene_51732 | MCS | Ampicillin | PMID:22718970 | Backbone Marker:Promega; Backbone Size:4600; Vector Backbone:pGl4.13; Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-29 01:06:43 | 0 | |||
|
p413TEF-SirT1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_51746 | SirT1 | Homo sapiens | Ampicillin | PMID:19390637 | Vector Backbone:p413TEF; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:06:43 | 2 | ||
|
p413TEF-Sir2 Resource Report Resource Website |
RRID:Addgene_51742 | Sir2 | Saccharomyces cerevisiae | Ampicillin | PMID:19390637 | Vector Backbone:p413TEF; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:06:43 | 0 | ||
|
ESAM-bio-His Resource Report Resource Website |
RRID:Addgene_51751 | ESAM | Homo sapiens | Ampicillin | PMID:25713122 | Article ref 20 | Backbone Marker:Yves Durocher, NRC; Backbone Size:6618; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:06:43 | 0 | |
|
EPHB1-bio-His Resource Report Resource Website 1+ mentions |
RRID:Addgene_51750 | EPHB1 | Homo sapiens | Ampicillin | PMID:25713122 | Article ref 19 | Backbone Marker:Yves Durocher, NRC; Backbone Size:6618; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:06:43 | 1 | |
|
ICAM5-bio-His Resource Report Resource Website |
RRID:Addgene_51759 | ICAM5 | Homo sapiens | Ampicillin | PMID:25713122 | Article ref 28 | Backbone Marker:Yves Durocher, NRC; Backbone Size:6618; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:06:43 | 0 | |
|
ICAM2-bio-His Resource Report Resource Website |
RRID:Addgene_51758 | ICAM2 | Homo sapiens | Ampicillin | PMID:25713122 | Article ref 27 | Backbone Marker:Yves Durocher, NRC; Backbone Size:6618; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:06:43 | 0 | |
|
FCGR2a-bio-His Resource Report Resource Website |
RRID:Addgene_51754 | FCGR2a | Homo sapiens | Ampicillin | PMID:25713122 | Article ref 22 | Backbone Marker:Yves Durocher, NRC; Backbone Size:6618; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:06:43 | 0 | |
|
lentiCRISPR - EGFP sgRNA 3 Resource Report Resource Website 1+ mentions |
RRID:Addgene_51762 | Cas9 | Synthetic | Ampicillin | PMID:24336571 | gRNA target sequence GGCCACAAGTTCAGCGTGTC These six EGFP-targeting lentiCRISPRs have EGFP-targeting sgRNAs cloned into the lentiCRISPR backbone plasmid (Addgene plasmid 49535) and are used in Fig 1B of Shalem*, Sanjana* et al (2014). If you want to clone your own targeting sequences, please use the lentiCRISPR backbone plasmid (Addgene plasmid 49535), as the sgRNA Type IIs cloning site is not present in these plasmids. Special note from the Zhang lab: We are constantly improving our CRISPR reagents. Please check https://zlab.bio/ for the most up-to-date information. | Backbone Marker:Zhang lab; Vector Backbone:lentiCRISPR (pXPR_001), Addgene plasmid #49535; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-29 01:06:43 | 2 | |
|
pCDNA3 T7 Jip1(delta JBD) Resource Report Resource Website |
RRID:Addgene_51767 | Jnk interacting protein 1 | Mus musculus | Ampicillin | PMID:9235893 | Backbone Marker:invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | deleted 126-263 | 2026-08-29 01:06:43 | 0 | |
|
lentiCRISPR - EGFP sgRNA 4 Resource Report Resource Website 1+ mentions |
RRID:Addgene_51763 | Cas9 | Synthetic | Ampicillin | PMID:24336571 | gRNA target sequence GGAGCGCACCATCTTCTTCA These six EGFP-targeting lentiCRISPRs have EGFP-targeting sgRNAs cloned into the lentiCRISPR backbone plasmid (Addgene plasmid 49535) and are used in Fig 1B of Shalem*, Sanjana* et al (2014). If you want to clone your own targeting sequences, please use the lentiCRISPR backbone plasmid (Addgene plasmid 49535), as the sgRNA Type IIs cloning site is not present in these plasmids. Special note from the Zhang lab: We are constantly improving our CRISPR reagents. Please check https://zlab.bio/ for the most up-to-date information. | Backbone Marker:Zhang lab; Vector Backbone:lentiCRISPR (pXPR_001), Addgene plasmid #49535; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-29 01:06:43 | 4 | |
|
KIAA-bio-His Resource Report Resource Website |
RRID:Addgene_51808 | KIAA | Homo sapiens | Ampicillin | PMID:25713122 | Article ref 31 | Backbone Marker:Yves Durocher, NRC; Backbone Size:6618; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:06:43 | 0 | |
|
JAM3-bio-His Resource Report Resource Website |
RRID:Addgene_51807 | JAM3 | Homo sapiens | Ampicillin | PMID:25713122 | Article ref 30 | Backbone Marker:Yves Durocher, NRC; Backbone Size:6618; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:06:43 | 0 | |
|
IL6ST-bio-His Resource Report Resource Website |
RRID:Addgene_51806 | IL6ST | Homo sapiens | Ampicillin | PMID:25713122 | Article ref 29 | Backbone Marker:Yves Durocher, NRC; Backbone Size:6618; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:06:43 | 0 | |
|
pfast bac cry1myc Resource Report Resource Website |
RRID:Addgene_51892 | cry1 | Mus musculus | Ampicillin | PMID:23452855 | Backbone Marker:Invitrogen; Vector Backbone:pfastbac; Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-29 01:06:44 | 0 | ||
|
pfast bac Rbx-HA Resource Report Resource Website |
RRID:Addgene_51893 | Rbx1 | Homo sapiens | Ampicillin | PMID:23452855 | Vector Backbone:pfastbac; Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-29 01:06:44 | 0 | ||
|
PRNP-bio-His Resource Report Resource Website |
RRID:Addgene_51811 | PRNP | Homo sapiens | Ampicillin | PMID:25713122 | Article ref 88 | Backbone Marker:Yves Durocher, NRC; Backbone Size:6618; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:06:43 | 0 | |
|
Alpha MHC-DN.JNK2 Resource Report Resource Website |
RRID:Addgene_51931 | DN JNK2 | Mus musculus | Ampicillin | PMID:14517246 | Addgene sequencing found the following additional mutations: S2G, S6C and G8S, they not thought to effect the function of the insert. | Vector Backbone:alphaMHC vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | dominant negative: the dual phosphorylation motif TPY was changed to APF | 2026-08-29 01:06:44 | 0 |
|
Syn-ATP Resource Report Resource Website 1+ mentions |
RRID:Addgene_51819 | Chimeric Synaptophysin-mCherry-Luciferase | Rattus norvegicus | Ampicillin | PMID:24529383 | Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Within WT luciferase gene, changed Threonine 214 to Alanine, changed Alanine 215 to Leucine, changed Isoleucine 232 to Alanine, changed Phenylalanine 295 to Leucine, changed Glutamic Acid 354 to Lysine, changed Isoleucine 423 to Leucine, and changed Aspartic Acid 436 to Glycine. | 2026-08-29 01:06:43 | 4 | |
|
pCS2+hSpCas9 Resource Report Resource Website 10+ mentions |
RRID:Addgene_51815 | humanized S.pyogenes Cas9 | Ampicillin | PMID:24728957 | This plasmid is modified from pX330-U6-Chimeric BB-CBh-hSpCas9 originated from Feng Zhang Lab. | Backbone Size:4071; Vector Backbone:pCS2; Vector Types:Mammalian Expression, CRISPR, medaka, zebrafish; Bacterial Resistance:Ampicillin | 2026-08-29 01:06:43 | 29 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.