Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Bacterial Resistance:ampicillin (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

328,858 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
R5 MCS
 
Resource Report
Resource Website 		RRID:Addgene_51732 MCS Ampicillin PMID:22718970 Backbone Marker:Promega; Backbone Size:4600; Vector Backbone:pGl4.13; Vector Types:; Bacterial Resistance:Ampicillin 2026-08-29 01:06:43 0
p413TEF-SirT1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_51746 SirT1 Homo sapiens Ampicillin PMID:19390637 Vector Backbone:p413TEF; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:06:43 2
p413TEF-Sir2
 
Resource Report
Resource Website 		RRID:Addgene_51742 Sir2 Saccharomyces cerevisiae Ampicillin PMID:19390637 Vector Backbone:p413TEF; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:06:43 0
ESAM-bio-His
 
Resource Report
Resource Website 		RRID:Addgene_51751 ESAM Homo sapiens Ampicillin PMID:25713122 Article ref 20 Backbone Marker:Yves Durocher, NRC; Backbone Size:6618; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:06:43 0
EPHB1-bio-His
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_51750 EPHB1 Homo sapiens Ampicillin PMID:25713122 Article ref 19 Backbone Marker:Yves Durocher, NRC; Backbone Size:6618; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:06:43 1
ICAM5-bio-His
 
Resource Report
Resource Website 		RRID:Addgene_51759 ICAM5 Homo sapiens Ampicillin PMID:25713122 Article ref 28 Backbone Marker:Yves Durocher, NRC; Backbone Size:6618; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:06:43 0
ICAM2-bio-His
 
Resource Report
Resource Website 		RRID:Addgene_51758 ICAM2 Homo sapiens Ampicillin PMID:25713122 Article ref 27 Backbone Marker:Yves Durocher, NRC; Backbone Size:6618; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:06:43 0
FCGR2a-bio-His
 
Resource Report
Resource Website 		RRID:Addgene_51754 FCGR2a Homo sapiens Ampicillin PMID:25713122 Article ref 22 Backbone Marker:Yves Durocher, NRC; Backbone Size:6618; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:06:43 0
lentiCRISPR - EGFP sgRNA 3
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_51762 Cas9 Synthetic Ampicillin PMID:24336571 gRNA target sequence GGCCACAAGTTCAGCGTGTC These six EGFP-targeting lentiCRISPRs have EGFP-targeting sgRNAs cloned into the lentiCRISPR backbone plasmid (Addgene plasmid 49535) and are used in Fig 1B of Shalem*, Sanjana* et al (2014). If you want to clone your own targeting sequences, please use the lentiCRISPR backbone plasmid (Addgene plasmid 49535), as the sgRNA Type IIs cloning site is not present in these plasmids. Special note from the Zhang lab: We are constantly improving our CRISPR reagents. Please check https://zlab.bio/ for the most up-to-date information. Backbone Marker:Zhang lab; Vector Backbone:lentiCRISPR (pXPR_001), Addgene plasmid #49535; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-29 01:06:43 2
pCDNA3 T7 Jip1(delta JBD)
 
Resource Report
Resource Website 		RRID:Addgene_51767 Jnk interacting protein 1 Mus musculus Ampicillin PMID:9235893 Backbone Marker:invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin deleted 126-263 2026-08-29 01:06:43 0
lentiCRISPR - EGFP sgRNA 4
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_51763 Cas9 Synthetic Ampicillin PMID:24336571 gRNA target sequence GGAGCGCACCATCTTCTTCA These six EGFP-targeting lentiCRISPRs have EGFP-targeting sgRNAs cloned into the lentiCRISPR backbone plasmid (Addgene plasmid 49535) and are used in Fig 1B of Shalem*, Sanjana* et al (2014). If you want to clone your own targeting sequences, please use the lentiCRISPR backbone plasmid (Addgene plasmid 49535), as the sgRNA Type IIs cloning site is not present in these plasmids. Special note from the Zhang lab: We are constantly improving our CRISPR reagents. Please check https://zlab.bio/ for the most up-to-date information. Backbone Marker:Zhang lab; Vector Backbone:lentiCRISPR (pXPR_001), Addgene plasmid #49535; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-29 01:06:43 4
KIAA-bio-His
 
Resource Report
Resource Website 		RRID:Addgene_51808 KIAA Homo sapiens Ampicillin PMID:25713122 Article ref 31 Backbone Marker:Yves Durocher, NRC; Backbone Size:6618; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:06:43 0
JAM3-bio-His
 
Resource Report
Resource Website 		RRID:Addgene_51807 JAM3 Homo sapiens Ampicillin PMID:25713122 Article ref 30 Backbone Marker:Yves Durocher, NRC; Backbone Size:6618; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:06:43 0
IL6ST-bio-His
 
Resource Report
Resource Website 		RRID:Addgene_51806 IL6ST Homo sapiens Ampicillin PMID:25713122 Article ref 29 Backbone Marker:Yves Durocher, NRC; Backbone Size:6618; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:06:43 0
pfast bac cry1myc
 
Resource Report
Resource Website 		RRID:Addgene_51892 cry1 Mus musculus Ampicillin PMID:23452855 Backbone Marker:Invitrogen; Vector Backbone:pfastbac; Vector Types:; Bacterial Resistance:Ampicillin 2026-08-29 01:06:44 0
pfast bac Rbx-HA
 
Resource Report
Resource Website 		RRID:Addgene_51893 Rbx1 Homo sapiens Ampicillin PMID:23452855 Vector Backbone:pfastbac; Vector Types:; Bacterial Resistance:Ampicillin 2026-08-29 01:06:44 0
PRNP-bio-His
 
Resource Report
Resource Website 		RRID:Addgene_51811 PRNP Homo sapiens Ampicillin PMID:25713122 Article ref 88 Backbone Marker:Yves Durocher, NRC; Backbone Size:6618; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:06:43 0
Alpha MHC-DN.JNK2
 
Resource Report
Resource Website 		RRID:Addgene_51931 DN JNK2 Mus musculus Ampicillin PMID:14517246 Addgene sequencing found the following additional mutations: S2G, S6C and G8S, they not thought to effect the function of the insert. Vector Backbone:alphaMHC vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin dominant negative: the dual phosphorylation motif TPY was changed to APF 2026-08-29 01:06:44 0
Syn-ATP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_51819 Chimeric Synaptophysin-mCherry-Luciferase Rattus norvegicus Ampicillin PMID:24529383 Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Within WT luciferase gene, changed Threonine 214 to Alanine, changed Alanine 215 to Leucine, changed Isoleucine 232 to Alanine, changed Phenylalanine 295 to Leucine, changed Glutamic Acid 354 to Lysine, changed Isoleucine 423 to Leucine, and changed Aspartic Acid 436 to Glycine. 2026-08-29 01:06:43 4
pCS2+hSpCas9
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_51815 humanized S.pyogenes Cas9 Ampicillin PMID:24728957 This plasmid is modified from pX330-U6-Chimeric BB-CBh-hSpCas9 originated from Feng Zhang Lab. Backbone Size:4071; Vector Backbone:pCS2; Vector Types:Mammalian Expression, CRISPR, medaka, zebrafish; Bacterial Resistance:Ampicillin 2026-08-29 01:06:43 29

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch