Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Genetic Insert: MCS with F2A and T2A
Vector Backbone Description: Backbone Marker:Agilent; Vector Backbone:pShuttle-CMV; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_62621 Copy
Species: Homo sapiens
Genetic Insert: CHRFAM7A
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5600; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25056953
Proper citation: RRID:Addgene_62638 Copy
Species: E. coli
Genetic Insert: Thr251Gly-EcPheRS
Vector Backbone Description: Backbone Marker:Qiagen; Backbone Size:4541; Vector Backbone:pQE-80L-Kan; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25691744
Comments: Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions.
Proper citation: RRID:Addgene_62598 Copy
Genetic Insert: exo, beta, gam, sgRNA
Vector Backbone Description: Vector Backbone:pKD46; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:26463009
Proper citation: RRID:Addgene_62654 Copy
Genetic Insert: Cas9 nuclease
Vector Backbone Description: Vector Backbone:pdCas9-bacteria; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:26463009
Comments: Please note that this plasmid runs as a dimer (>13kb). While this may reduce DNA yield, the plasmid still functions as expected.
Proper citation: RRID:Addgene_62655 Copy
Genetic Insert: exo, beta, gam, sgRNA
Vector Backbone Description: Vector Backbone:pKD46; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:26463009
Proper citation: RRID:Addgene_62656 Copy
Species: Synthetic
Genetic Insert: mtZFN(-)2G
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5427; Vector Backbone:pcDNA3.1(-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24567072
Proper citation: RRID:Addgene_62799 Copy
Species: Homo sapiens
Genetic Insert: CenpA
Vector Backbone Description: Vector Backbone:N1 Cloning Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_62742 Copy
Species: Mus musculus
Genetic Insert: Talin
Vector Backbone Description: Vector Backbone:C1 Cloning Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_62763 Copy
Species: Homo sapiens
Genetic Insert: PML-IV
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pLPC; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21205865
Comments: The PML isoform in this plasmid is referred to as PML-IV according to the nomenclature established by Jensen, Shiels and Freemont Oncogene. 2001 Oct 29;20(49):7223-33. The GenBank nomenclature for PML-IV is PML isoform 6 (GenBank ID NM_002675.3).
Proper citation: RRID:Addgene_62804 Copy
Species: Synthetic
Genetic Insert: gRNA
Vector Backbone Description: Vector Backbone:pFG001; Vector Types:Bacterial Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_62816 Copy
Species: Synthetic
Genetic Insert: gRNA
Vector Backbone Description: Vector Backbone:pFG018; Vector Types:Bacterial Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Tetracycline
Proper citation: RRID:Addgene_62817 Copy
Species: Synthetic
Genetic Insert: SYNZIP3
Vector Backbone Description: Backbone Marker:Qiagen; Backbone Size:4892; Vector Backbone:pQE-2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22558529
Proper citation: RRID:Addgene_80659 Copy
Species: Synthetic
Genetic Insert: SYNZIP2
Vector Backbone Description: Backbone Marker:Qiagen; Backbone Size:4892; Vector Backbone:pQE-2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22558529
Proper citation: RRID:Addgene_80658 Copy
Species: Other
Genetic Insert: pME-mKate2 no stop
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2518; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:27500400
Proper citation: RRID:Addgene_80806 Copy
Vector Backbone Description: Backbone Marker:Feng Zhang lab (Plasmid #71814); Backbone Size:8506; Vector Backbone:eSpCas9(1.1); Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28179459
Proper citation: RRID:Addgene_80768 Copy
Species: Synthetic
Genetic Insert: PITCh-gRNA#3 targeting sequence (GCATCGTACGCGTACGTGTT)
Vector Backbone Description: Backbone Marker:Kazuhisa Nakayama Lab. (Addgene plasmid #80766); Backbone Size:4761; Vector Backbone:pDonor-tBFP-NLS-Neo; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:28179459
Proper citation: RRID:Addgene_80767 Copy
Vector Backbone Description: Backbone Size:5018; Vector Backbone:pUC19; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19716372
Comments: Annotated sequence available from:
www.ebi.ac.uk/ena
accession number LT615370
Proper citation: RRID:Addgene_80797 Copy
Species: Synthetic
Genetic Insert: Monomeric streptavidin
Vector Backbone Description: Backbone Marker:Homemade; Backbone Size:5300; Vector Backbone:pET-IG; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26979420
Proper citation: RRID:Addgene_80706 Copy
Species: Synthetic
Genetic Insert: SYNZIP4
Vector Backbone Description: Backbone Marker:Qiagen; Backbone Size:4892; Vector Backbone:pQE-2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22558529
Proper citation: RRID:Addgene_80660 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
