Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: Drosha shRNA
Vector Backbone Description: Backbone Size:7700; Vector Backbone:pSicoR PGK puro; Vector Types:Mammalian Expression, Lentiviral, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17401365
Comments: shRNA sequence: TGAAGCTCTT TGGTGAATAA TTCAAGAGAT TATTCACCAA AGAGCTTCTT TTTTC
Proper citation: RRID:Addgene_14767 Copy
Genetic Insert: EGFPd2
Vector Backbone Description: Backbone Size:4779; Vector Backbone:pCAGEN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17209010
Proper citation: RRID:Addgene_14760 Copy
Species: Mus musculus
Genetic Insert: Hmga2 wt
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17322030
Comments: The 3' UTR of the mouse Hmga2 cDNA (BC052158) was subcloned into pCR2.1-TOPO (Invitrogen) for site-directed mutagenesis. To disrupt each let-7 complementary site, the nucleotides that paired to nucleotides 3 and 5 of the miRNA were substituted (see Author's map), using the Quikchange site-directed mutagenesis kit (Stratagene). The UTR fragment was then cloned back into the vector containing the Hmga2 cDNA (pCMV•SPORT6.1). To construct the mammalian expression vectors, Hmga2 inserts were excised from the pCMV•SPORT6.1 constructs using EcoRI restriction sites and cloned into pcDNA3.1 (Invitrogen).
Proper citation: RRID:Addgene_14789 Copy
Species: Mus musculus
Genetic Insert: let-7g
Vector Backbone Description: Backbone Marker:BD Biosciences; Backbone Size:6500; Vector Backbone:MSCV-neo; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17401365
Comments: miRNA of the following mature sequence, with approximately 500 basepairs of flanking sequence, were cloned into MSCV-neo: let-7g: 5’-UGAGG UAGUA GUUUG UACAG U-3’.
Proper citation: RRID:Addgene_14784 Copy
Species: Mus musculus
Genetic Insert: Luc-wt
Vector Backbone Description: Backbone Marker:Available from Addgene (#12179); Backbone Size:4000; Vector Backbone:pIS1; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17322030
Comments: The 3' UTR of the mouse Hmga2 cDNA (BC052158) was subcloned into pCR2.1-TOPO (Invitrogen) for site-directed mutagenesis. To disrupt each let-7 complementary site, the nucleotides that paired to nucleotides 3 and 5 of the miRNA were substituted (see Author's map), using the Quikchange site-directed mutagenesis kit (Stratagene). To construct the Renilla luciferase reporters, wild-type and mutant Hmga2 3' UTRs were amplified (PCR primers, 5'-GCGTCTCGAGGGGCGCCGACATTC and 5'GGCGCGGCCGCAGTCAGAGGGCACAC) and cloned into the XbaI and NotI sites of pIS1.
Proper citation: RRID:Addgene_14785 Copy
Species: Homo sapiens
Genetic Insert: Smad3 NL
Vector Backbone Description: Backbone Marker:Genentech; Backbone Size:4700; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9094310
Comments: See Author's map for cloning details.
Proper citation: RRID:Addgene_14828 Copy
Species: Homo sapiens
Genetic Insert: Retinoblastoma Binding Protein 2
Vector Backbone Description: Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17320163
Comments: The plasmid encodes isoform 2.
Proper citation: RRID:Addgene_14799 Copy
Species: Homo sapiens
Genetic Insert: Smad3 C
Vector Backbone Description: Backbone Marker:Genentech; Backbone Size:4700; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9094310
Comments: See Author's map for cloning details.
Proper citation: RRID:Addgene_14830 Copy
Species: Rattus norvegicus
Genetic Insert: TGF beta type I receptor
Vector Backbone Description: Backbone Marker:Genentech; Backbone Size:4700; Vector Backbone:pRK5 modified with flag; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8662796
Comments: See Author's map for more information.
A 9bp linker was added directly upstream of the GS domain. The linker encodes the amino acids GSM. The additional sequence does not affect plasmid function.
Proper citation: RRID:Addgene_14831 Copy
Species: Mus musculus
Genetic Insert: Hmga2 m7
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17322030
Comments: The 3' UTR of the mouse Hmga2 cDNA (BC052158) was subcloned into pCR2.1-TOPO (Invitrogen) for site-directed mutagenesis. To disrupt each let-7 complementary site, the nucleotides that paired to nucleotides 3 and 5 of the miRNA were substituted (see Author's map), using the Quikchange site-directed mutagenesis kit (Stratagene). The UTR fragment was then cloned back into the vector containing the Hmga2 cDNA (pCMV•SPORT6.1). To construct the mammalian expression vectors, Hmga2 inserts were excised from the pCMV•SPORT6.1 constructs using EcoRI restriction sites and cloned into pcDNA3.1 (Invitrogen).
Full sequence of wild-type plasmid available at Addgene plasmid #14789.
Proper citation: RRID:Addgene_14792 Copy
Vector Backbone Description: Backbone Size:8846; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Comments: See Fire Lab Vector Kit Documentation 1995. Fire Lab Miniprep Number pPD95.16, Ligation number NONE.
Proper citation: RRID:Addgene_1483 Copy
Species: Mus musculus
Genetic Insert: Smad7
Vector Backbone Description: Backbone Size:5100; Vector Backbone:pBabe puro 3; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10791980
Comments: See Author's map for more information.
Proper citation: RRID:Addgene_14836 Copy
Species: Mus musculus
Genetic Insert: K-ras 3'UTR
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4045; Vector Backbone:pRL-TK; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17401365
Proper citation: RRID:Addgene_14804 Copy
Species: Rattus norvegicus
Genetic Insert: DAG reporter
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12782683
Comments: CFP and YFP fused to the C1A and C1B domains of PKCbetaII. DAGR was created by PCR of the C1A and C1B domains of rat PKCßII (aa 37–152) from KpnI to XhoI and substitution for the PH domain in CYPHR.
Proper citation: RRID:Addgene_14865 Copy
Genetic Insert: C kinase activity reporter
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12782683
Comments: The MyrPalm tag in this plasmid uses the Lyn kinase amino terminal sequence of MGCIKSK from UniProtKB reference sequence P07948.3. This sequence encodes for myristoylation and palmitoylation, shown previously to be sufficient to target a protein to the plasma membrane.
Proper citation: RRID:Addgene_14862 Copy
Genetic Insert: C kinase activity reporter
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12782683
Comments: PKC substrate sequence flanked by flexible linker sequence: GGSGG RFRRFQTLKIKAKA GGSGG. A206K mutation present in both CFP (mCFP) and citrine (mYFP) to reduce the intrinsic homoaffinity of all GFPs and preclude intermolecular FRET by CFP-YFP dimerization. CFP was amplified by PCR from a plasmid template to encode a HindIII restriction site followed by a consensus initiation site for translation (CGCCACC) before the initiating ATG of CFP, and a KpnI restriction site at the 3' end instead of a terminating codon. FHA2, a gift from Michael Yaffe (MIT, Cambridge, MA) was amplified by PCR to include KpnI and BamHI restriction sites at the 5' and 3' ends, respectively. Citrine was amplified by PCR to include a 5' BamHI followed by the PKC substrate sequence and a 3' XbaI following the terminating codon.
Proper citation: RRID:Addgene_14860 Copy
Genetic Insert: C kinase activity reporter
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16901905
Comments: NucCKAR was generated by fusing sequences encoding a basic nuclear localization signal, PKKRKVEDA, to the 3'-end of CKAR .
Proper citation: RRID:Addgene_14869 Copy
Genetic Insert: B kinase activity reporter
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2900; Vector Backbone:pRSET B; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15583002
Comments: PKB substrate sequence: RKRDRLGTLGI.
Proper citation: RRID:Addgene_14877 Copy
Species: Rattus norvegicus
Genetic Insert: DAG binding domain
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16901905
Comments: YFP-tagged DAG binding domain (YFP-DBD) was first constructed by fusion of monomeric YFP to the 5'-end of the C1b domain of PKCbeta. This construct was improved for DAG binding by introducing the Y123W point mutation via QuikChange (Stratagene).
Proper citation: RRID:Addgene_14874 Copy
Genetic Insert: CFP
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16901905
Comments: Sequences encoding the amino-terminal 35 residues of endothelial nitric-oxide synthase were fused in frame to the 5'-end of CFP.
Proper citation: RRID:Addgene_14873 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
