Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: ELK4
Vector Backbone Description: Backbone Marker:PMID 9733867; Vector Backbone:pLgw RFC1-V5-EcoDam; Vector Types:Mammalian Expression, Lentiviral, DamID; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26146939
Proper citation: RRID:Addgene_98607 Copy
Species: Mus musculus
Genetic Insert: NKX2-5 Y191C
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2718; Vector Backbone:pENTR 2B; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26146939
Comments: The mouse NKX2-5Y191C mutant was generated by site-directed mutagenesis of the Nkx2-5 cDNA using the following primer and its reverse complement: TCCAGAACCGTCGCTGCAAGTGCAAGCGACAG. Insert contains Kozak sequence and no stop codon
Proper citation: RRID:Addgene_98613 Copy
Species: Mus musculus
Genetic Insert: Gata4
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2718; Vector Backbone:pENTR 2B; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26146939
Comments: Insert contains Kozak sequence and no stop codon
Proper citation: RRID:Addgene_98615 Copy
Species: Mus musculus
Genetic Insert: TBX5
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2718; Vector Backbone:pENTR 2B; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26146939
Comments: Insert contains Kozak sequence and no stop codon
Proper citation: RRID:Addgene_98619 Copy
Species: Mus musculus
Genetic Insert: Casp1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:5700; Vector Backbone:pCFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:28533778
Proper citation: RRID:Addgene_98849 Copy
Species: Mus musculus
Genetic Insert: GFPL10
Vector Backbone Description: Backbone Marker:Deisseroth Lab; Backbone Size:5524; Vector Backbone:pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28753423
Proper citation: RRID:Addgene_98704 Copy
Species: Mus musculus
Genetic Insert: rGBD
Vector Backbone Description: Backbone Marker:invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29937389
Comments:
Proper citation: RRID:Addgene_99015 Copy
Species: Mus musculus
Genetic Insert: Mdk shRNA
Vector Backbone Description: Backbone Marker:MIT; Backbone Size:7649; Vector Backbone:pLL3.7; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28398003
Comments: This plasmid was generated as part of the NIAAA-funded INIA consortium.
Proper citation: RRID:Addgene_99025 Copy
Species: Mus musculus
Genetic Insert: Signal transducer and activator of transcription 3 - Y705F
Vector Backbone Description: Backbone Marker:Thermo Fisher; Backbone Size:34621; Vector Backbone:pAdCMV/V5-DEST; Vector Types:Adenoviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29351406
Comments: *E16K mutation in STAT3
Proper citation: RRID:Addgene_99261 Copy
Species: Mus musculus
Genetic Insert: Signal transducer and activator of transcription 3
Vector Backbone Description: Backbone Marker:Thermo Fisher; Backbone Size:34621; Vector Backbone:pAdCMV/V5-DEST; Vector Types:Adenoviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29351406
Comments: *E16K mutation in STAT3
Proper citation: RRID:Addgene_99260 Copy
Species: Mus musculus
Genetic Insert: Signal transducer and activator of transcription 3 - S727D
Vector Backbone Description: Backbone Marker:Thermo Fisher; Backbone Size:34621; Vector Backbone:pAdCMV/V5-DEST; Vector Types:Adenoviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29351406
Comments: *E16K mutation in STAT3
Proper citation: RRID:Addgene_99263 Copy
Species: Mus musculus
Genetic Insert: CBP ZZ domain
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5443; Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15476823
Proper citation: RRID:Addgene_99334 Copy
Species: Mus musculus
Genetic Insert: mouse CBP BRD-ZZ domains (1079-1751)
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5493; Vector Backbone:pET22b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28630323
Proper citation: RRID:Addgene_99341 Copy
Species: Mus musculus
Genetic Insert: mouse CBP BRD-ZZ domains (1079-1751) DeltaAL
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5493; Vector Backbone:pET22b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28630323
Proper citation: RRID:Addgene_99551 Copy
Species: Mus musculus
Genetic Insert: Pak3
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3791; Vector Backbone:pCMV- myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23622267
Proper citation: RRID:Addgene_99510 Copy
Species: Mus musculus
Genetic Insert: mouse CBP BRD (1079-1198)
Vector Backbone Description: Backbone Marker:NEB; Backbone Size:4970; Vector Backbone:pGEX4T2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23831576
Proper citation: RRID:Addgene_99507 Copy
Species: Mus musculus
Genetic Insert: CREB3L3
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5502; Vector Backbone:pcDNA3.1 V5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15800215
Proper citation: RRID:Addgene_99509 Copy
Species: Mus musculus
Genetic Insert: dCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG)
Vector Backbone Description: Vector Backbone:pAAV (pUC f1); Vector Types:AAV, CRISPR; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.1101/298620 for bioRxiv preprint.
Proper citation: RRID:Addgene_99695 Copy
Species: Mus musculus
Genetic Insert: Gt(Rosa)26Sor
Vector Backbone Description: Vector Backbone:pBlueScript KS II; Vector Types:Mouse Targeting; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28802047
Proper citation: RRID:Addgene_99627 Copy
Species: Mus musculus
Genetic Insert: Kras
Vector Backbone Description: Backbone Size:5958; Vector Backbone:388-MCS AAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29233960
Comments: https://benchling.com/s/seq-GnrunufwzMMMiUzJgwLR
Proper citation: RRID:Addgene_99848 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
