Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
On page 384 showing 7661 ~ 7680 out of 12,972 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

http://www.addgene.org/99729

Species: Mus musculus
Genetic Insert: Tmeff2
Vector Backbone Description: Vector Backbone:pCDH-CMV-MCS-EF1-nlsCopGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28336932

Proper citation: RRID:Addgene_99729 Copy   

    • RRID:Addgene_99752

    This resource has 1+ mentions.

http://www.addgene.org/99752

Species: Mus musculus
Genetic Insert: HIs-H2B-Cherry, H2B-EGFP-V5, HA-H2B-Cerulean, DN-Maml1, NICD-PEST
Vector Backbone Description: Vector Backbone:pBlueScript KS; Vector Types:Mammalian Expression, Mouse Targeting, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28802047
Comments: Please note that several discrepancies were found between Addgene's quality control and the depositor's sequence. The depositor noted that these discrepancies do NOT affect plasmid function.

Proper citation: RRID:Addgene_99752 Copy   

http://www.addgene.org/99850

Species: Mus musculus
Genetic Insert: Kras
Vector Backbone Description: Backbone Size:5958; Vector Backbone:388-MCS AAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29233960
Comments: https://benchling.com/s/seq-Fo9yObwqPPQCG479P7Ll

Proper citation: RRID:Addgene_99850 Copy   

http://www.addgene.org/99852

Species: Mus musculus
Genetic Insert: Kras
Vector Backbone Description: Backbone Size:5958; Vector Backbone:388-MCS AAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29233960
Comments: https://benchling.com/s/seq-ZwWNXX7tP0bisKZNlE3U

Proper citation: RRID:Addgene_99852 Copy   

http://www.addgene.org/99854

Species: Mus musculus
Genetic Insert: Kras
Vector Backbone Description: Backbone Size:5958; Vector Backbone:388-MCS AAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29233960
Comments: https://benchling.com/s/seq-VYuSAajucKlD3iRxltcy

Proper citation: RRID:Addgene_99854 Copy   

http://www.addgene.org/99853

Species: Mus musculus
Genetic Insert: Kras
Vector Backbone Description: Backbone Size:5958; Vector Backbone:388-MCS AAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29233960
Comments: https://benchling.com/s/seq-atBNRmhI5tEHkQKLBbHp

Proper citation: RRID:Addgene_99853 Copy   

    • RRID:Addgene_99735

    This resource has 1+ mentions.

http://www.addgene.org/99735

Species: Mus musculus
Genetic Insert: SaCas9 gRNA targeting Yap1
Vector Backbone Description: Backbone Marker:Feng Zhang Lab; Vector Backbone:pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA (Addgene Plasmid #61591); Vector Types:Mammalian Expression, AAV, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27926730

Proper citation: RRID:Addgene_99735 Copy   

http://www.addgene.org/99734

Species: Mus musculus
Genetic Insert: SaCas9 gRNA targeting Yap1
Vector Backbone Description: Backbone Marker:Feng Zhang Lab; Vector Backbone:pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA (Addgene Plasmid #61591); Vector Types:Mammalian Expression, AAV, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27926730

Proper citation: RRID:Addgene_99734 Copy   

http://www.addgene.org/99857

Species: Mus musculus
Genetic Insert: Kras
Vector Backbone Description: Backbone Size:5958; Vector Backbone:388-MCS AAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29233960
Comments: https://benchling.com/s/seq-J6bsGpWfPgLvKgL4LbPm

Proper citation: RRID:Addgene_99857 Copy   

http://www.addgene.org/99859

Species: Mus musculus
Genetic Insert: Kras
Vector Backbone Description: Backbone Size:5958; Vector Backbone:388-MCS AAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29233960
Comments: https://benchling.com/s/seq-2y1YV8OIA9ubvJVqQRkH

Proper citation: RRID:Addgene_99859 Copy   

    • RRID:Addgene_99749

    This resource has 1+ mentions.

http://www.addgene.org/99749

Species: Mus musculus
Genetic Insert: MbYFP, MbTomato, MbKate2, DN-Rbpj and NICD-PEST
Vector Backbone Description: Vector Backbone:pBlueScript KS; Vector Types:Mammalian Expression, Mouse Targeting, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28802047

Proper citation: RRID:Addgene_99749 Copy   

    • RRID:Addgene_183431

http://www.addgene.org/183431

Species: Mus musculus
Genetic Insert: gRNA
Vector Backbone Description: Vector Backbone:pOC2; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35851300
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.01.02.474730v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_183431 Copy   

http://www.addgene.org/183435

Species: Mus musculus
Genetic Insert: gRNA and Halo-FKBP donor
Vector Backbone Description: Vector Backbone:pOC2; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35851300
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.01.02.474730v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_183435 Copy   

http://www.addgene.org/181976

Species: Mus musculus
Genetic Insert: GATA1 gRNA: CCTAGACCAGGAAAATCCAT
Vector Backbone Description: Vector Backbone:pLeGO.iG2 ; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36493345

Proper citation: RRID:Addgene_181976 Copy   

    • RRID:Addgene_182642

http://www.addgene.org/182642

Species: Mus musculus
Genetic Insert: CDMPR
Vector Backbone Description: Backbone Marker:Clontech/Takara Bio; Backbone Size:7181; Vector Backbone:pQCXIP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35314489

Proper citation: RRID:Addgene_182642 Copy   

http://www.addgene.org/183436

Species: Mus musculus
Genetic Insert: gRNA and smFP HA donor
Vector Backbone Description: Vector Backbone:pOC3; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35851300
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.01.02.474730v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_183436 Copy   

    • RRID:Addgene_183443

    This resource has 1+ mentions.

http://www.addgene.org/183443

Species: Mus musculus
Genetic Insert: gRNA and 2xGFP donor
Vector Backbone Description: Vector Backbone:pORANGE; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35851300
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.01.02.474730v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_183443 Copy   

    • RRID:Addgene_183440

http://www.addgene.org/183440

Species: Mus musculus
Genetic Insert: gRNA and GFP donor
Vector Backbone Description: Vector Backbone:pOC5; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35851300
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.01.02.474730v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_183440 Copy   

http://www.addgene.org/83251

Species: Mus musculus
Genetic Insert: Stat5a
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pAD/CMV/V5-DEST; Vector Types:Adenoviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27131881

Proper citation: RRID:Addgene_83251 Copy   

http://www.addgene.org/172443

Species: Mus musculus
Genetic Insert: Cacng2
Vector Backbone Description: Vector Backbone:pmCherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:35486148
Comments: Read the preprint on bioRxiv: https://www.biorxiv.org/content/10.1101/2021.04.23.441091v3.

Proper citation: RRID:Addgene_172443 Copy   

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch