Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: DICER-Promoter upstream Ebox Mut
Vector Backbone Description: Backbone Size:5394; Vector Backbone:pGL3 basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20550935
Proper citation: RRID:Addgene_25852 Copy
Species: Homo sapiens
Genetic Insert: hsa-miR-30c
Vector Backbone Description: Backbone Size:7650; Vector Backbone:pLL3.7; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19584398
Comments: miR-30c sequence: 5'TGTAAACATCCTACACTCTCAGC3'
Proper citation: RRID:Addgene_25797 Copy
Species: Homo sapiens
Genetic Insert: hsa-miR-150
Vector Backbone Description: Backbone Size:7650; Vector Backbone:pLL3.7; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19584398
Proper citation: RRID:Addgene_25792 Copy
Species: Homo sapiens
Genetic Insert: hsa-miR-34a
Vector Backbone Description: Backbone Size:7650; Vector Backbone:pLL3.7; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19584398
Proper citation: RRID:Addgene_25791 Copy
Species: Homo sapiens
Genetic Insert: shRNA against human MYB
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:6400; Vector Backbone:pSIREN-RetroQ; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19584398
Proper citation: RRID:Addgene_25790 Copy
Species: Homo sapiens
Genetic Insert: Hypoxia inducible factor 2 alpha
Vector Backbone Description: Backbone Size:5140; Vector Backbone:HA-pBabe-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17220275
Proper citation: RRID:Addgene_25936 Copy
Species: Homo sapiens
Genetic Insert: RapR-p38
Vector Backbone Description: Backbone Size:4600; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20581846
Comments: Note that the Addgene quality control sequence does not match the author-supplied sequence exactly. There is NO PstI site at the end of the insert.
Proper citation: RRID:Addgene_25935 Copy
Species: Homo sapiens
Genetic Insert: pWPI_SPbFGF
Vector Backbone Description: Backbone Size:11101; Vector Backbone:pWPI; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17728358
Proper citation: RRID:Addgene_25812 Copy
Species: Homo sapiens
Genetic Insert: npc1
Vector Backbone Description: Backbone Marker:invitrogen; Backbone Size:5000; Vector Backbone:pFASTBAC; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19563754
Comments: There is a TEV cleavage site downstream of His tag.
Proper citation: RRID:Addgene_25773 Copy
Species: Homo sapiens
Genetic Insert: npc1
Vector Backbone Description: Backbone Marker:invitrogen; Backbone Size:5000; Vector Backbone:pFASTBAC; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19563754
Comments: There is a TEV cleavage site downstream of His tag.
Proper citation: RRID:Addgene_25772 Copy
Species: Homo sapiens
Genetic Insert: LDL receptor EGFAB
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pGEX; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19224862
Comments: This plasmid was generated in the Deisenhofer lab but first described in J Biol Chem. 2009 Apr 17. 284(16):10561-70.
Proper citation: RRID:Addgene_25771 Copy
Species: Homo sapiens
Genetic Insert: shRNA against human CDK6
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:6400; Vector Backbone:pSIREN-RetroQ; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19584398
Proper citation: RRID:Addgene_25789 Copy
Species: Homo sapiens
Genetic Insert: H2B-CFP
Vector Backbone Description: Backbone Size:6406; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20526348
Proper citation: RRID:Addgene_25998 Copy
Species: Homo sapiens
Genetic Insert: H2B-GFP
Vector Backbone Description: Backbone Size:6380; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20526348
Comments: Second AgeI site is introduced preventing AgeI-EcoRI shRNA subcloning. TRC library shRNAs can be subcloned as an AccI fragment or SphI-SacII fragment.
Proper citation: RRID:Addgene_25999 Copy
Species: Homo sapiens
Genetic Insert: Cdc20
Vector Backbone Description: Backbone Marker:See note below; Backbone Size:4700; Vector Backbone:pVenus-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18997788
Comments: EYFP was swapped with Venus using AgeI and BsrGI restriction sites.
Proper citation: RRID:Addgene_26059 Copy
Species: Homo sapiens
Genetic Insert: L-Myc
Vector Backbone Description: Backbone Marker:Dr. Toshio Kitamura of the University of Tokyo; Backbone Size:6340; Vector Backbone:pMXs; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20660764
Proper citation: RRID:Addgene_26022 Copy
Species: Homo sapiens
Genetic Insert: ATP-binding cassette, sub-family G (WHITE), member 2, variant of isoform 2
Vector Backbone Description: Backbone Marker:James Thomson; Backbone Size:6500; Vector Backbone:pSIN-EF2-MCS-IRES-Neo; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19670287
Comments: Please note that the backbone of this plasmid is larger than the reported 6.5kb (see attached diagnostic digest).
Proper citation: RRID:Addgene_25983 Copy
Species: Homo sapiens
Genetic Insert: CD11b promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:3199; Vector Backbone:pGEM3zf-; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7811988
Comments: The cloned CD11b promoter in this construct contains some 5'UTR, including the transcription start site.
Proper citation: RRID:Addgene_26168 Copy
Species: Homo sapiens
Genetic Insert: RAB25:HPC038-B06:C25773
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7328; Vector Backbone:pET28a-LIC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 2OIL
http://www.thesgc.org/structures/2OIL/
Proper citation: RRID:Addgene_26163 Copy
Species: Homo sapiens
Genetic Insert: Hypoxia inducible factor 2 alpha
Vector Backbone Description: Backbone Size:5140; Vector Backbone:pBabe-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12086860
Proper citation: RRID:Addgene_26091 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
